Car12 (NM_178396) Mouse Untagged Clone

CAT#: MC211740

Car12 (untagged) - Mouse carbonic anyhydrase 12 (Car12), (10ug)


  "NM_178396" in other vectors (4)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Car12"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Car12
Synonyms 2310047E01Rik; AI314958; CA-XII; Ca12
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211740 representing NM_178396
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCTCACCGCAGCCTGCGCGCGACTGTCGTCCTCCTGTTGGTGATCCTTAAGAAGCAGCCTTCCAGCT
CAGCCCCACTCAACGGATCCAAGTGGACCTATGTTGGTCCTGCTGGGGAAAAGAACTGGTCCAAGAAGTA
CCCATCGTGTGGAGGCCTCCTGCAGTCCCCGATAGACCTACATAGCGACATCCTTCAGTATGATGCTAGC
CTCGCACCCCTCCAGTTCCAAGGTTACAATGTGTCTGTTGAAAAGCTGTTGAACCTGACCAATGATGGCC
ATTCAGTGAGACTGAATCTGAACTCAGACATGTACATCCAGGGTCTCCAGCCTCACCACTACAGAGCAGA
GCAGCTGCACTTGCACTGGGGGAACCGCAATGACCCCCATGGCTCTGAACACACCGTGAGTGGGAAGCAC
TTTGCTGCCGAGCTGCACATTGTCCATTATAACTCAGACCTGTACCCTGACTTCAGCACCGCCAGTGACA
AGTCCGAAGGCCTCGCTGTCCTTGCTGTTCTTATTGAGATAGGCTCCGCCAATCCATCATATGACAAGAT
CTTCAGCCATCTTCAACATGTTAAGTATAAAGGCCAACAAGTGCTCATCCCAGGCTTCAACATTGAAGAA
CTTCTGCCCGAGAGCCCTGGCGAGTATTACCGCTATGAAGGGTCCCTGACTACACCTCCTTGCTACCCTA
CCGTGCTCTGGACAGTTTTCCGAAACCCTGTGCAGATTTCCCAGGAGCAGCTGCTGGCTTTGGAGACAGC
TCTGTACTTCACACACATGGATGATCCTACCCCCAGAGAAATGATCAACAACTTCCGGCAGGTCCAGAAG
TTCGATGAGAGGCTGGTGTATATCTCCTTCCGACAAGGACTGCTTACCAACACAGGACTGAGTTTGGGTA
TCATCCTTTCAGTGGCCCTGGCTGGCGTTCTTGGCATCTCCATTGTTCTGGCAGTGTCTATTTGGCTCTT
CAAAAGGAAGAAGAGCAAAAAAGGTGACAACAAGGGAGTCATTTATAAACCAGCCATCAAGAAGGAGGCT
GAGGTCCACGCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_178396
Insert Size 1065 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC035941, AAH35941
RefSeq Size 3716 bp
RefSeq ORF 1065 bp
Locus ID 76459
UniProt ID Q8CI85
Cytogenetics 9 C
Gene Summary This gene encodes a membrane-bound member of the alpha carbonic anhydrase family of enzymes that catalyze the reversible hydration of carbon dioxide to bicarbonate. These proteins participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.