Pcgf5 (NM_029508) Mouse Untagged Clone
CAT#: MC211706
Pcgf5 (untagged) - Mouse polycomb group ring finger 5 (Pcgf5), (10ug)
"NM_029508" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Pcgf5 |
Synonyms | 0610009F02Rik; 1110054A01Rik; 5830406C17Rik; 5830443C21Rik; 9530023M17Rik; AI324127 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211706 representing NM_029508
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTACCCAAAGGAAACACTTGGTGAAAGACTTCAACCCTTACATCACCTGCTACATCTGTAAAGGCT ATCTGATCAAGCCCACGACAGTGACGGAATGCCTCCATACATTCTGTAAGACCTGTATTGTCCAGCACTT TGAAGACAGCAATGATTGTCCAAGGTGTGGCAACCAAGTTCATGAAACAAATCCATTAGAAATGTTAAGG CTGGATAACACGTTGGAGGAAATTATCTTTAAATTAGTGCCTGGACTACGAGAACAAGAACTTCAGCGTG AGTTGGAATTTTGGAAGAAAAACAAACCTCAAGAAAATGGGCAAGATGATATTTCGAAGGTTGACAAGTC TAAAGCAGATGAGGAAGGTGATGAAAACCAAGATGATAAGGACTATCATAGAAGTGACCCGCAAATTGCT ATCTGTCTGGACTGTTTACGAAATAATGGGCAGTCAGGGGACAACGTAGTGAAGGGTCTCATGAAGAAAT TTATTCGCTGTTCTACACGAGTTACTGTAGGAACTATTAAAAAGTTTCTAAGTTTAAAACTAAAACTTCC AAGTTCTTATGAGTTGGATGTGCTGTGCAATGGTGAAATTATGGGAAAGGATCATACTATGGAATTCATC TATATGACAAGATGGCGACTAAGAGGAGAAAATTCATACCCGATGGTATTGCAGTATCGACCGAGAATTG ATTTTGGGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_029508 |
Insert Size | 711 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_029508.3, NP_083784.1 |
RefSeq Size | 1509 bp |
RefSeq ORF | 711 bp |
Locus ID | 76073 |
UniProt ID | Q3UK78 |
Cytogenetics | 19 C2 |
Gene Summary | Component of a Polycomb group (PcG) multiprotein PRC1-like complex, a complex class required to maintain the transcriptionally repressive state of many genes, including Hox genes, throughout development. PcG PRC1 complex acts via chromatin remodeling and modification of histones; it mediates monoubiquitination of histone H2A 'Lys-119', rendering chromatin heritably changed in its expressibility (PubMed:27136092, PubMed:28596365). Within the PRC1-like complex, regulates RNF2 ubiquitin ligase activity (By similarity). Plays a redundant role with PCGF3 as part of a PRC1-like complex that mediates monoubiquitination of histone H2A 'Lys-119' on the X chromosome and is required for normal silencing of one copy of the X chromosome in XX females (PubMed:28596365).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG224590 | Pcgf5 (tGFP-tagged) - Mouse polycomb group ring finger 5 (Pcgf5), (10ug) |
USD 650.00 |
|
MR224590 | Pcgf5 (Myc-DDK-tagged) - Mouse polycomb group ring finger 5 (Pcgf5) |
USD 450.00 |
|
MR224590L3 | Lenti ORF clone of Pcgf5 (Myc-DDK-tagged) - Mouse polycomb group ring finger 5 (Pcgf5) |
USD 750.00 |
|
MR224590L4 | Lenti ORF clone of Pcgf5 (mGFP-tagged) - Mouse polycomb group ring finger 5 (Pcgf5) |
USD 750.00 |
{0} Product Review(s)
Be the first one to submit a review