Malsu1 (NM_029353) Mouse Untagged Clone

CAT#: MC211666

Malsu1 (untagged) - Mouse RIKEN cDNA 2410003K15 gene (2410003K15Rik), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Malsu1
• Synonyms: 2410003K15Rik; Matsu1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC211666 representing NM_029353
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGTCCGGGCTGGTCGCCCGCGCGGCGTTTATGGCCGCTGCTGTGGCGCAGGGCGGTCTTCCAGAGAG
  CCGGCCCCGCAATGGCTTCGGTTCCCTGGCTTCCGCGGCTGGCAGAGCGATGGCTTCCCGCGAGGCCCGC
  GACCTGCCTGACCCCGAGCCTAACGCGCGGCCTGCACCATGGGCCTCAGCCCGAGGAGCGGACCGCTGGC
  GACGCTCGCCTGCAGCCCGGACCCGCAGATCACATTGGTGCCAAGTTTGACATCGATATGCTGGTTTCAC
  TTCTGAGGCAAGAAAATGCAAGAGACATTTGTGTGATCCAGGTTCCTCCAGAAATGAGATACACAGACTA
  CTTTGTGATTGGGAGTGGGACTTCCACCCGACACTTACACGCTATGGTCCACTACCTTGTGAAGATGTAT
  AAACACCTGAAATGTAGAAGCGATCCGTATGTCAAGATCGAGGGGAAGGACGCTGACGACTGGCTGTGTG
  TGGACTTTGGGAGTATGGTGATCCATTTGATGCTTCCAGAAACCAGAGAAACCTATGAATTAGAGAAACT
  ATGGACTCTACGTTCTTTTGATGACCAGTTAGCTCAGATAGCAGCTGAGACGTTACCTGAAGACTTCATT
  CTTGGACTGGAAGATGACACTTCATCCCTGACTCCAGTGGAGTTCAAATGTAAATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_029353
• Insert Size: 687 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_029353.1, NP_083629.1
• RefSeq Size: 785 bp
• RefSeq ORF: 687 bp
• Locus ID: 75593
• UniProt ID: Q9CWV0
• Cytogenetics: 6
• Gene Summary: Required for normal mitochondrial ribosome function and mitochondrial translation. May play a role in ribosome biogenesis by preventing premature association of the 28S and 39S ribosomal subunits. Interacts with mitochondrial ribosomal protein L14 (MRPL14), probably blocking formation of intersubunit bridge B8, preventing association of the 28S and 39S ribosomal subunits. Addition to isolated mitochondrial ribosomal subunits partially inhibits translation, probably by interfering with the association of the 28S and 39S ribosomal subunits and the formation of functional ribosomes. May also participate in the assembly and/or regulation of the stability of the large subunit of the mitochondrial ribosome. May function as a ribosomal silencing factor.[UniProtKB/Swiss-Prot Function]