Tmem114 (NM_029070) Mouse Untagged Clone

CAT#: MC211558

Cldn26 (untagged) - Mouse claudin 26 (Cldn26), (10ug)

USD 402.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tmem114 (NM_029070) Mouse Untagged Clone
Symbol Tmem114
Synonyms 4930511J11Rik; Cldn26
Vector pCMV6-Entry
Sequence Data
>MC211558 representing NM_029070
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCGGGTGCGCCTGGGCGCTCTGGCGGGAGCGGCGGCGCTGAGCGGGGCTCTGAGCTTCGTGCTGCTGG
CAGCAGCCATCGGCACCGACTTCTGGTACATCATCGACACCGAGAGGCTGGAAAGGAGCAGCCAGAGGAT
GAGGGACCAGGGACCGGCCAACCGCAGCCAGCAAGAGCCTCTGAGCTCCCACTCGGGACTCTGGAGAACT
TGCCGGGTCCAGAGCTCCTGCACGCCGTTGATGAACCCTTTCTGGCAGGAGAATGTGACGGTCAGCGACT
CCAGCAGACAGCTTCTCACTATGCACGGGACATTCGTGATCTTATTGCCACTCAGTCTGATCGTGATGGT
GTTTGGGGGGATGACCGGGTTCTTGAGCTTCCTCCTCCGAGCTCACCTCCTTCTGCTGCTCACCGGGATC
CTCTTTCTCTTTGGAGCCATGGTGACCCTCACTGGAATCAGCATCTACATTGCGTACTCAGCAGTTGCCT
TCCGAGAGGCAGTATGCCTCCTGGAGGAGAGGGCCCTGCTGGATCAGGTGGATATACGCTTTGGCTGGTC
TCTGGCCCTCGGCTGGATTAGCTTTGTATCTGAGCTGCTCACTGGGGTGGTCTTCCTGGCAGCGGCGCGT
GCGCTCAGCCTGAGCCAGAGGCAGGACCAAGCCATCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_029070
ORF Size 669 bp
Insert Size 669
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_029070.2, NP_083346
RefSeq Size 1406
RefSeq ORF 669
Locus ID 74720
Cytogenetics 16|16 A1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.