Cd200r3 (NM_001128132) Mouse Untagged Clone
CAT#: MC211541
Cd200r3 (untagged) - Mouse CD200 receptor 3 (Cd200r3), transcript variant 1, (10ug)
"NM_001128132" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Cd200r3 |
Synonyms | 4733401I18Rik; 4833409J19Rik; AI505817; BB106877; mCD200RLb |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211541 representing NM_001128132
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_001128132 |
Insert Size | 837 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001128132.1, NP_001121604.1 |
RefSeq Size | 1622 bp |
RefSeq ORF | 837 bp |
Locus ID | 74603 |
UniProt ID | Q5UKY4 |
Cytogenetics | 16 B4- B5 |
Gene Summary | According to PubMed:15187158 isoform 4 is a receptor for the CD200 cell surface glycoprotein. According to PubMed:16081818 isoform 4 is not a receptor for the CD200/OX2 cell surface glycoprotein. Isoform 1, isoform 2 and isoform 3 are involved in the recruitment or surface expression of the TYROBP receptor. Isoform 6, isoform 7 and isoform 8 are not involved in the recruitment or surface expression of the TYROBP receptor.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG218430 | Cd200r3 (tGFP-tagged) - Mouse CD200 receptor 3 (Cd200r3) transcript variant 1, (10ug) |
USD 530.00 |
|
MR218430 | Cd200r3 (Myc-DDK-tagged) - Mouse CD200 receptor 3 (Cd200r3), transcript variant 1 |
USD 330.00 |
|
MR218430L3 | Lenti ORF clone of Cd200r3 (Myc-DDK-tagged) - Mouse CD200 receptor 3 (Cd200r3), transcript variant 1 |
USD 630.00 |
|
MR218430L4 | Lenti ORF clone of Cd200r3 (mGFP-tagged) - Mouse CD200 receptor 3 (Cd200r3), transcript variant 1 |
USD 630.00 |
{0} Product Review(s)
Be the first one to submit a review