Isca2 (NM_028863) Mouse Untagged Clone

CAT#: MC211519

Isca2 (untagged) - Mouse iron-sulfur cluster assembly 2 homolog (S. cerevisiae) (Isca2), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Isca2
• Synonyms: 0710001C05Rik; 5730594E03Rik; Hbld1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC211519 representing NM_028863
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGGCCTCCAGGGCCTTGTCCCTAACTGCCGAGGCGGTCAGGGCTGTCATTCCTAGGCGCTCGGGAA
  GGCTCCTCGCCGTCTTTCCCAGGCTTTTGACCCGCTGGGAAACAACATCTTCCATTCCAGAGGCTGGCGA
  GGGACAGATCCGCCTCACAGACAGCTGCGTCCAGAGGCTTCTGGAAATCACCGAAGGGTCAGAATTCCTC
  AGGCTGCAAGTAGAGGGAGGTGGATGCTCCGGATTCCAATACAAATTTTCACTGGATACAGTTATTAACC
  CCGACGACAGGGTATTTGAACAGGGTGGGGCAAGAGTGGTGGTTGACTCTGATAGCTTGGCCTTCGTTAA
  GGGAGCCCAGGTGGACTTCAGCCAAGAACTGATCCGAAGCTCATTCCAAGTGTTGAATAACCCTCAAGCC
  CAGCAAGGCTGCTCCTGTGGGTCATCCTTCTCTGTCAAAGTCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_028863
• Insert Size: 465 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_028863.1, NP_083139.1
• RefSeq Size: 868 bp
• RefSeq ORF: 465 bp
• Locus ID: 74316
• UniProt ID: Q9DCB8
• Cytogenetics: 12 D1
• Gene Summary: Involved in the maturation of mitochondrial 4Fe-4S proteins functioning late in the iron-sulfur cluster assembly pathway. May be involved in the binding of an intermediate of Fe/S cluster assembly.[UniProtKB/Swiss-Prot Function]