Smim24 (NM_001099917) Mouse Untagged Clone

CAT#: MC211307

2210404O07Rik (untagged) - Mouse RIKEN cDNA 2210404O07 gene (2210404O07Rik), (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Smim24 (NM_001099917) Mouse Untagged Clone
Symbol Smim24
Synonyms 2210404O07Rik
Vector pCMV6-Entry
Sequence Data
>MC211307 representing NM_001099917
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACACCTTGGGCAGGCTGCTGCTGCTGGCTACACTGTTCCTGACACCCGCTGAGGCCCAGCAGGCCT
CAGAGCGCCGCCTGAAGCCTTGGCTAGTAGGCCTGGCTGCAGTAGTGGGCTTCCTGTTTATAGTCTTCAT
CCTCATGCTGGCCAATCGTGTCTGGTGCGCCAAAGGCAGAGCAGAGGATGAGGAGGCTACATTCAGAATG
GAGCACATTATGAACGAGAACTCACAGCCAAGTAAAGCAGACAAGAAGCAGAAGAAGAAGGTGGACAGGA
AGGGCGGACAGAGCAACGAGGCCTTGGAACTAGAGGAAAAGGAGTCCTCAGATGAGGAGAGAGGCAAGAA
AACAGCTTTGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001099917
ORF Size 363 bp
Insert Size 363
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001099917.1, NP_001093387
RefSeq Size 575
RefSeq ORF 363
Locus ID 72273
Cytogenetics 10|10 C1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.