Colec11 (NM_027866) Mouse Untagged Clone

CAT#: MC211215

Colec11 (untagged) - Mouse collectin sub-family member 11 (Colec11), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Colec11
• Synonyms: CL-K1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC211215 representing NM_027866
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATGATGAGGGACCTGGCTCTTGCAGGCATGCTGATTAGCCTGGCTTTCCTGTCCCTGCTGCCATCTG
  GATGTCCTCAGCAGACCACAGAGGACGCCTGCTCTGTGCAGATTCTTGTCCCTGGCCTCAAAGGGGATGC
  AGGAGAAAAGGGAGACAAAGGAGCCCCAGGACGGCCAGGAAGAGTCGGCCCTACAGGAGAAAAAGGAGAC
  ATGGGGGACAAAGGACAGAAAGGCACTGTGGGCCGCCATGGAAAAATTGGTCCCATTGGCGCAAAAGGTG
  AAAAAGGAGATTCTGGTGATATCGGACCCCCTGGCCCCAGTGGAGAACCTGGTATTCCATGTGAGTGCAG
  TCAGCTGAGGAAGGCTATTGGGGAGATGGACAACCAGGTCACTCAACTGACAACTGAGCTAAAATTCATA
  AAAAATGCTGTTGCTGGCGTGCGCGAGACTGAGAGCAAGATCTACCTGCTGGTGAAGGAGGAGAAGCGGT
  ACGCAGATGCCCAGCTGTCCTGCCAAGCCCGAGGCGGCACACTGAGCATGCCCAAAGACGAGGCAGCCAA
  TGGCCTGATGGCTTCATACCTGGCACAGGCTGGCCTGGCCCGAGTCTTCATCGGTATCAATGACCTGGAG
  AAAGAAGGTGCTTTCGTGTACTCGGACCGCTCCCCCATGCAGACCTTCAACAAGTGGCGCAGTGGAGAGC
  CCAACAACGCCTATGATGAGGAGGACTGTGTGGAGATGGTGGCCTCAGGTGGCTGGAATGATGTGGCCTG
  CCACATTACCATGTACTTCATGTGCGAGTTTGACAAAGAGAACTTGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_027866
• Insert Size: 819 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_027866.2, NP_082142.1
• RefSeq Size: 1424 bp
• RefSeq ORF: 819 bp
• Locus ID: 71693
• UniProt ID: Q3SXB8
• Cytogenetics: 12 A2
• Gene Summary: This gene encodes a member of the collectin family of C-type lectins that possess collagen-like sequences and carbohydrate recognition domains. Collectins are secreted proteins that play important roles in the innate immune system by binding to carbohydrate antigens on microorganisms, facilitating their recognition and removal. The encoded protein binds to multiple sugars with a preference for fucose and mannose. Mutations in the human gene are a cause of 3MC syndrome-2. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.