9130008F23Rik (NM_027834) Mouse Untagged Clone

CAT#: MC211201

9130008F23Rik (untagged) - Mouse RIKEN cDNA 9130008F23 gene (9130008F23Rik), (10ug)


  "NM_027834" in other vectors (4)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "9130008F23Rik"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol 9130008F23Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211201 representing NM_027834
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACTATCTACCCTCCGGGATGGAGCTGGGCAGACCCCAAGGGCGCTCTGAGTGCTCTCCGCGCCGGG
AGGGGTGTGGGCCACCCTTGGATTCTGGCTCCCCTAATCCTGCGCTGGCGGAGGCGGGAAGTGCCCAATC
AATAGCAAGTGGGAACTTGAGAAAGCAGAAGGGAAAGAATTTGGATTGCCAGTCCTGGGTCAGAGAGAAA
GTGCTCTTTCTTCTGCACCCGGAGAGGTGGTTGGGAACACAGGCGGACTCTGCTTGCGCAGGGCTGGTGG
ACAGCGAGAACCTTCCCCCGACGATTGGAGACCACTACGATTCCAAACGGAAACCAAAGCTTTCCCGCAG
GCGCATTGCCACGGCCCCGGGGGCCCAGCCCGAGGACCCCGAAAACACACCCAGGTCCCTGTTGGTGCGG
GTCGTGGATTACCAGGTGACACAGGAGGTGCTGTGGACCGCATGGACCAAGGGGAGTATGACCACGAGGA
CCGAGGAGCGTTCTGTGACCGCAGTCACCTTTCGGACACAGAGGGAGAGGGAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_027834
Insert Size 546 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_027834.3, NP_082110.1
RefSeq Size 2159 bp
RefSeq ORF 546 bp
Locus ID 71583
Cytogenetics 17 B2

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.