Dmrtc1a (NM_027591) Mouse Untagged Clone

CAT#: MC211110

Dmrtc1a (untagged) - Mouse DMRT-like family C1a (Dmrtc1a), transcript variant 1, (10ug)

USD 402.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Dmrtc1a (NM_027591) Mouse Untagged Clone
Symbol Dmrtc1a
Synonyms 1700030H14Rik; 4921520P21Rik; Dmrt8.1; DMRTC1
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC211110 representing NM_027591
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGCGGTCTTCGGGTTCCCGGGAACCTCGTAAGGACTTTTCTCCTGTGACCACCTCCAAGAAGGAGG
AGGCTACCCCATTAAAGAGACGCCTGGTTGAGAGACATAAAAGGACTATGGCTGCTGCTCATCCATCACA
CATGCACGTCAAGAAATTGGCTGTAGAAGAAGGAGTTCGCACTGGAAAGAACACTGTGCAGCAGATCCAG
GCCCAGGTTGACACAGCAACCCAGGAGGAGAGCTCCCAAGGGCCTGTGCTGCTGAACCAGCACCCAGAAA
CAACATCTGTGCCATATACTCCAGAGACTGTGGGGCAACAACTGATGGTGTCCCTTCCTGGGGAGCCCCA
TGGGACCTCTGCCATGCCAAGCATGTGTCCAAGCCTGATTCTTCAGCCCTGTGCCACCACTGACCCTATG
CTACTGCAACCACAGGTCATGGGCCCCAGTGCCTCCAACCAGGCTTCAGTTTCTGCTACCTTAGAGTGGC
AGGAGATGCTGGAGGCTGCTGAAGCTCTGCTGGCTCTGAAAAATTCGTCTCAGACACGTCACCAGCCCTG
TGGCATGCCAGTGAAGAGAGAGCTAAGCGGAGCATCACGTATGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_027591
ORF Size 606 bp
Insert Size 606
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_027591.3, NP_081867
RefSeq Size 1247
RefSeq ORF 606
Locus ID 70887
Cytogenetics X|X D
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.