Rasl12 (NM_001162923) Mouse Untagged Clone

CAT#: MC211099

Reviews ()
Write a review

Rasl12 (untagged) - Mouse RAS-like, family 12 (Rasl12), transcript variant 2, (10ug)


Product Datasheet for 'MC211099'


  "NM_001162923" in other vectors (4)

USD 420.00


Availability*
2 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Rasl12 (NM_001162923) Mouse Untagged Clone
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rasl12
Synonyms 4631404I11Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>MC211099 representing NM_001162923
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGTCGGTGTTCGGCAAGCCCCGAGCTGGCAGCGGGCCGCACAGCGTGCCCCTGGAAGTTAACCTGG
CTATCCTTGGGCGCCGCGGAGCGGGCAAGTCTGCCCTGACGGTGAAGTTCCTCACCAAGAGGTTTATCAG
CGAATATGATCCCAATTTGGAGGACACCTACAGCTCTGAGGAGACTGTGGACCACCAGCCTGTGCACCTG
AGGGTCATGGACACTGCAGACCTGGACACCCCCAGGAACTGCGAGCGCTACCTGAACTGGGCCCATGCCT
TCTTGGTGGTGTATAGTGTCGATAGTCGTGCGAGTTTCGAGGGCAGCAGCAGCTACCTAGAGCTGCTGGC
CTTGCATGCCAAGGAGACACAACGTGGCTACCCTGCTCTGCTGCTGGGCAACAAGCTTGACATGGCCCAG
TACAGGTTTACCCACACCACTGGACATGCGTGTAAGACCCAATCCTACGCATGGCTCCCACTGCCTCCTC
AACCTGACAGTCCTTCTAATAATCCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001162923
ORF Size 519 bp
Insert Size 519
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001162923.1, NP_001156395.1
RefSeq Size 1949
RefSeq ORF 519
Locus ID 70784
Cytogenetics 9 C

Other Versions

Other products for "Rasl12"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools