OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Qpct (NM_027455) Mouse Untagged Clone

Be the first to review this product
SKU
MC211077
Qpct (untagged) - Mouse glutaminyl-peptide cyclotransferase (glutaminyl cyclase) (Qpct), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
  $686.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Qpct or NM_027455"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Qpct
Synonyms 5730422A13Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC211077 representing NM_027455
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGGCAGCGAAGACAAGCTCGTCGTGGGCACTCTCCACCTGCTGCTACTGCAGGCGACCGTCCTGT
CTCTGACAGCTGGGAATCTGAGTCTGGTCTCCGCTGCCTGGACGCAGGAGAAGAACCACCACCAACCAGC
ACATTTGAATTCTTCATCTCTTCAGCAAGTTGCAGAAGGCACTAGCATTTCTGAAATGTGGCAAAACGAC
TTGAGACCATTGCTGATAGAACGATATCCTGGATCGCCCGGAAGCTATTCTGCTCGGCAGCACATCATGC
AACGAATTCAGAGACTTCAGGCTGAGTGGGTCGTGGAAGTTGACACCTTCCTGAGTAGGACTCCCTATGG
CTATCGGTCCTTCTCAAATATCATCAGCACTCTTAACCCGGAAGCGAAACGACACCTGGTCCTCGCCTGC
CACTACGACTCCAAATATTTTCCTCGATGGGACAGCAGAGTGTTTGTGGGAGCCACGGATTCAGCTGTGC
CATGTGCAATGATGTTGGAACTTGCCCGTGCCTTAGACAAGAAACTCCATTCCTTGAAGGATGTCTCTGG
TTCCAAGCCAGATCTCTCACTCCGGCTAATTTTCTTTGATGGTGAAGAGGCTTTTCATCACTGGTCCCCT
CAAGATTCTCTGTATGGGTCTCGGCACTTAGCTCAGAAGATGGCATCAAGCCCTCACCCTCCTGGATCAA
GAGGCACCAACCAACTGGATGGCATGGATCTGTTGGTCTTACTAGATTTAATTGGAGCAGCAAATCCAAC
ATTCCCTAATTTTTTCCCCAAGACTACCAGATGGTTTAATAGACTTCAAGCAATTGAAAAGGAACTCTAT
GAATTGGGATTACTCAAGGATCATTCTTTGGAGAGGAAGTATTTTCAGAATTTTGGCTATGGAAATATTA
TCCAGGATGACCACATTCCATTTTTAAGAAAAGGTGTCCCAGTTCTTCACCTGATAGCTTCTCCTTTCCC
TGAAGTCTGGCACACCATGGATGACAATGAAGAAAATCTACATGCGTCAACCATTGACAATCTCAACAAA
ATCATTCAAGTCTTTGTGTTGGAATATCTTCACTTGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI |
ACCN NM_027455
Insert Size 1089 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC151027, AAI51028
RefSeq Size 1924 bp
RefSeq ORF 1089 bp
Locus ID 70536
UniProt ID Q9CYK2
Cytogenetics 17 E3
Summary Responsible for the biosynthesis of pyroglutamyl peptides. Has a bias against acidic and tryptophan residues adjacent to the N-terminal glutaminyl residue and a lack of importance of chain length after the second residue (By similarity).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_027455" in other vectors (4)
SKU Description Size Price
MG216989 Qpct (tGFP-tagged) - Mouse glutaminyl-peptide cyclotransferase (glutaminyl cyclase) (Qpct), (10ug) 10 ug
$425.00
MR216989 Qpct (Myc-DDK-tagged) - Mouse glutaminyl-peptide cyclotransferase (glutaminyl cyclase) (Qpct) 10 ug
$225.00
MR216989L3 Lenti ORF clone of Qpct (Myc-DDK-tagged) - Mouse glutaminyl-peptide cyclotransferase (glutaminyl cyclase) (Qpct) 10 ug
$525.00
MR216989L4 Lenti ORF clone of Qpct (mGFP-tagged) - Mouse glutaminyl-peptide cyclotransferase (glutaminyl cyclase) (Qpct) 10 ug
$525.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products