Ifi35 (NM_027320) Mouse Untagged Clone

CAT#: MC211040

Ifi35 (untagged) - Mouse interferon-induced protein 35 (Ifi35), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ifi35
• Synonyms: 2010008K16Rik; AW986054; ifi-35; IFP35
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC211040 representing NM_027320
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCTGTGACCCTGCAAACTGTCCTCTACAGTCTTCAGGAGGAGCAAGCCAGGCTCAAGATGAGGCTGC
  AGGAGCTGCAGCAGCTCAAAAGGGAGCGCACAGGCTCTCCCGGAGCCAAGATCCCATTCTCAGTACCTGA
  AGTTCCTCTGGTATTCCAAGGCCAAACTAAGCAGGGCAGGCAAGTGCCCAAGTTTGTAGTTTCTAACTTG
  AAGGTCTGCTGCCCTCTGCCTGAAGGTTCTGCTCTGGTCACCTTTGAGGACCCCAAAGTGGTTGATCGGT
  TGCTACAACAAAAGGAACACAGAGTTAACTTAGAGGACTGCCGGCTGCGGGTGCAGGTCCAGCCCTTGGA
  GCTGCCTGTGGTGACCAACATTCAGGTGTCCAGCCAGCCAGATAACCACAGGGTGCTCGTTAGTGGTTTT
  CCTGCTGGACTTAGGCTGAGTGAAGAGGAACTGTTGGACAAGCTGGAGATCTTCTTTGGCAAGGCCAAGA
  ATGGAGGTGGGGATGTAGAGACCCGGGAGATGCTGCAAGGGACCGTCATGCTAGGGTTTGCTGATGAAGA
  AGTGGCCCAGCACTTATGCCAGATTGGCCAGTTCAGAGTCCCACTGGACCGGCAGCAGGTCCTCCTGAGG
  GTCTCTCCCTATGTGAGTGGTGAGATCCAGAAAGCCGAGATCAAATTCCAGCAAGCCCCTCATTCAGTGC
  TGGTGACAAATATTCCTGATGTCATGGATGCCCAGGAACTGCATGACATCCTTGAGATCCACTTCCAGAA
  GCCCACTCGTGGGGGCGGGGAGGTGGAGGCCCTGACAGTTGTGCCTTCAGGGCAGCAGGGCCTGGCTATC
  TTCACTTCCGAGTCAAGCTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_027320
• Insert Size: 861 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_027320.4, NP_081596.1
• RefSeq Size: 1360 bp
• RefSeq ORF: 861 bp
• Locus ID: 70110
• UniProt ID: Q9D8C4
• Cytogenetics: 11 D
• Gene Summary: Acts as a signaling pathway regulator involved in innate immune system response (PubMed:29350881). In response to interferon IFN-alpha, associates in a complex with transcriptional regulator NMI to regulate immune response; the complex formation prevents proteasome-mediated degradation of IFI35 and correlates with IFI35 dephosphorylation (By similarity). In complex with NMI, inhibits virus-triggered type I interferon/IFN-beta production (By similarity). In complex with NMI, negatively regulates nuclear factor NF-kappa-B signaling by inhibiting the nuclear translocation, activation and transcription of the NF-kappa-B subunit p65/RELA, resulting in the inhibition of endothelial cell proliferation, migration and re-endothelialization of injured arteries (PubMed:29350881). Beside its role as an intracellular signaling pathway regulator, also functions extracellularly as damage-associated molecular patterns (DAMPs) to promote inflammation when actively released by macrophage to the extracellular space during cell injury and pathogen invasion (By similarity). Macrophage-secreted IFI35 activates NF-kappa-B signaling in adjacent macrophages through Toll-like receptor 4/TLR4 activation, thereby inducing NF-kappa-B translocation from the cytoplasm into the nucleus which promotes the release of proinflammatory cytokines (By similarity).[UniProtKB/Swiss-Prot Function]