Cenps (NM_027263) Mouse Untagged Clone

CAT#: MC211020

Apitd1 (untagged) - Mouse apoptosis-inducing, TAF9-like domain 1 (Apitd1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cenps
• Synonyms: 2610040C18Rik; 2810407L01Rik; CENP-S
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC211020 representing NM_027263
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGGAGGTGGAGGCTGAGGAGCCGCAGGAGTTCTCTCACCGGCAGAGGCTGAAGGCGGCAGTTCACT
  ACACGGTCGGCTGTCTCTGCCAGGAAGTCACGCTGAACAAACAGGTGAACTTCAGCAAACAGACCATCGC
  GGCGATCTCCGAGGTGACTTTTCGACAGTGCGAAAATTTTGCCAAAGACCTTGAAATGTTTGCCAGACAC
  GCGAAAAGAAGCACGGTCACCACTGAAGACGTGAAGCTCTTAGCCAGGCGAAATAATTCACTGCTAAAAT
  ACATTACAGAGAAGAATGAAGAGATTGCCCAGCTTAACCTGAAAGGAAAGGCCAAGAAGAAAAGAAAGCC
  GGAAGATGAAAGCAGGAGCTCTCGGGAGTCCATGGCTGAGGAGCTGGACGGGGCTGAGGAGCTGCAGAGC
  GAGAGCTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_027263
• Insert Size: 429 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_027263.2, NP_081539.1
• RefSeq Size: 930 bp
• RefSeq ORF: 429 bp
• Locus ID: 69928
• UniProt ID: Q9D084
• Cytogenetics: 4 E2
• Gene Summary: DNA-binding component of the Fanconi anemia (FA) core complex. Required for the normal activation of the FA pathway, leading to monoubiquitination of the FANCI-FANCD2 complex in response to DNA damage, cellular resistance to DNA cross-linking drugs, and prevention of chromosomal breakage. In complex with CENPX (MHF heterodimer), crucial cofactor for FANCM in both binding and ATP-dependent remodeling of DNA. Stabilizes FANCM. In complex with CENPX and FANCM (but not other FANC proteins), rapidly recruited to blocked forks and promotes gene conversion at blocked replication forks. In complex with CENPT, CENPW and CENPX (CENP-T-W-S-X heterotetramer), involved in the formation of a functional kinetochore outer plate, which is essential for kinetochore-microtubule attachment and faithful mitotic progression. As a component of MHF and CENP-T-W-S-X complexes, binds DNA and bends it to form a nucleosome-like structure. DNA-binding function is fulfilled in the presence of CENPX, with the following preference for DNA substates: Holliday junction > double-stranded > splay arm > single-stranded. Does not bind DNA on its own.[UniProtKB/Swiss-Prot Function]