Tcf23 (NM_053085) Mouse Untagged Clone
CAT#: MC211015
Tcf23 (untagged) - Mouse transcription factor 23 (Tcf23), (10ug)
"NM_053085" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Tcf23 |
Synonyms | 2010002O16Rik; bHLHa24; Out |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211015 representing NM_053085
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCACAGGAGGCCACAGAGGCACCAGCAATGCCAGGAGAAGGGCATGGTCATAATAAGGCCAAGGCAC GGTGGCTTCTAGGCACTGACAGGAAGAGGAGTCGCATCAACAGGACAAGGCAGGACCTGTGGGAGGACAC TAGCTGGAGCAATCACAGACTGAGCAGAGCCACCTCTGCCCCTCGAGGGACCAGAGCTAGGGGAACAGCT CATGGCAGGAGTGAGGCCAGCCCGGAGAACGCAGCACGGGAACGGACTCGGGTGAAGACGCTTCGTCAGG CCTTTCTGGCCCTGCAGGCTGCTCTGCCCGCAGTGCCACCCGACACCAAGCTTTCCAAGTTGGATGTGCT CGTGCTGGCCACAAGCTACATTGCCCACCTCACCCGGACCCTCGGCCATGAGTTGCCTGGCCCTGCCTGG CCTCCCTTCGTGCGTGGACTCCGTTACTTGCACCCGCTAAAGAAGTGGCCCATGCGATCTCGTCTCTATG CAGGAGGCTTGGGATGCTCTGACCTCGATTCCACCACAGCTATCACGACCGGCCAAAGATGCAAGGATGC AGAGCTGGGGTCTCAAGACTCTGTAGCCGCAGAAAGTCTCCTGACCTCTCCAGCTTTTGGTAACAAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_053085 |
Insert Size | 630 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_053085.2, NP_444315.1 |
RefSeq Size | 4101 bp |
RefSeq ORF | 630 bp |
Locus ID | 69852 |
UniProt ID | Q9JLR5 |
Cytogenetics | 5 B1 |
Gene Summary | Inhibits E-box-mediated binding and transactivation of bHLH factors. Inhibitory effect is similar to that of ID proteins. Inhibits the formation of TCF3 and MYOD1 homodimers and heterodimers. Lacks DNA binding activity. May be involved in the regulation or modulation of smooth muscle contraction of the uterus during pregnancy and particularly around the time of delivery. Seems to play a role in the inhibition of myogenesis.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG216995 | Tcf23 (tGFP-tagged) - Mouse transcription factor 23 (Tcf23), (10ug) |
USD 650.00 |
|
MR216995 | Tcf23 (Myc-DDK-tagged) - Mouse transcription factor 23 (Tcf23) |
USD 450.00 |
|
MR216995L3 | Lenti ORF clone of Tcf23 (Myc-DDK-tagged) - Mouse transcription factor 23 (Tcf23) |
USD 750.00 |
|
MR216995L4 | Lenti ORF clone of Tcf23 (mGFP-tagged) - Mouse transcription factor 23 (Tcf23) |
USD 750.00 |
{0} Product Review(s)
Be the first one to submit a review