Rab43 (NM_133717) Mouse Untagged Clone

CAT#: MC211014

Rab43 (untagged) - Mouse RAB43, member RAS oncogene family (Rab43), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Rab43
• Synonyms: 1810048P08Rik; 2500004H21Rik; AW490415
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC211014 representing NM_133717
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGTGTGTTCTACAGGCTGGAGGCCATTGTTACTGTTACAGATTTGGGACACAGCTGGCCAGGAGCGGT
  TCCGGACCATCACCCAGAGCTACTACCGAAGTGCCAATGGGGCTATCCTTGCGTACGACATCAGCAAGAG
  GAGCACCTTCTTGTCAGTGCCTCACTGGATCGAGGATGTGAGGAAGTACGCGGGTTCCAACATCGTGCAG
  CTGCTGATTGGGAACAAGTCAGACCTTGCCGATTTCCGGGAGGTCCCATTGGCGGAGGCACAGAGCCTGG
  CTGAGCACTATGACATCCTCTGTGCCATCGAGACCTCCGCAAAGGACTCCAGCAATGTGGAGGAGGCCTT
  CACCAGAGTGGCCACGGAGCTCATCATGAGGCACGGAGGTCCCATGTTCAGTGAGAAGAACACAGACCAC
  ATCCAGCTGGACAGCAAGGACATTGCGGAGAGCTGGGGCTGTGGGTGCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_133717
• Insert Size: 471 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_133717.3, NP_598478.1
• RefSeq Size: 4311 bp
• RefSeq ORF: 471 bp
• Locus ID: 69834
• Cytogenetics: 6 D1
• Gene Summary: The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different set of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. The low intrinsic GTPase activity of RAB43 is activated by USP6NL. Involved in retrograde transport from the endocytic pathway to the Golgi apparatus. Involved in the transport of Shiga toxin from early and recycling endosomes to the trans-Golgi network. Required for the structural integrity of the Golgi complex. Plays a role in the maturation of phagosomes that engulf pathogens, such as S.aureus and Mycobacterium.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) contains an alternate 5' terminal exon and initiates translation at an alternate start codon, compared to variant 1. It encodes isoform b, which is shorter and has a distinct N-terminus, compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.