Nkiras1 (NM_023526) Mouse Untagged Clone

CAT#: MC210995

Nkiras1 (untagged) - Mouse NFKB inhibitor interacting Ras-like protein 1 (Nkiras1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Nkiras1
• Synonyms: 2400004O09Rik; kappaB-Ras1; KBRAS1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210995 representing NM_023526
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGGAAGGGTTGCAAGGTTGTCATTTGTGGGTTGCTGTCTGTTGGGAAAACTGCAATTTTGGAGCAAC
  TCCTTTATGGGAATCACACTATTGGGATGGAAGACTGTGAAACGCTGGAAGACGTGTACATGGCATCTGT
  AGAGACAGACCGTGGGGTGAAGGAGCAGCTGCACTTGTATGACACCCGAGGCCTGCAGAAAGGCGTGGAG
  CTGCCAAAGCATTACTTCTCATTTGCTGATGGCTTTGTTCTTGTGTATAGTGTGAATAACCTTGAGTCCT
  TCCAAAGAGTGGAGCTTCTGAAGAAAGAGATTGATAAGTTCAAAGACAAAAAGGAGGTGGCAATCGTTGT
  GTTAGGAAACAAACTGGACCTTTCTGAGCAGAGACAGGTGGATGCTGACGTGGCACAACAGTGGGCAAGA
  AGTGAGAAAGTCAAGCTGTGGGAGGTGACAGTGACAGACCGGAGGACACTGATTGAACCCTTCACTTTAC
  TGGCCAGCAAGCTTTCTCAGCCCCAGAGCAAATCCAGCTTCCCTTTGCCTGGGAGGAAAAACAAAGGGAA
  CTCCAATCCCGAAAACTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_023526
• Insert Size: 579 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_023526.4, NP_076015.2
• RefSeq Size: 4610 bp
• RefSeq ORF: 579 bp
• Locus ID: 69721
• UniProt ID: Q8CEC5
• Cytogenetics: 14 A1
• Gene Summary: Atypical Ras-like protein that acts as a potent regulator of NF-kappa-B activity by preventing the degradation of NF-kappa-B inhibitor beta (NFKBIB) by most signals, explaining why NFKBIB is more resistant to degradation. May act by blocking phosphorylation of NFKBIB and mediating cytoplasmic retention of p65/RELA NF-kappa-B subunit. It is unclear whether it acts as a GTPase. Both GTP- and GDP-bound forms block phosphorylation of NFKBIB (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) encodes the longest isoform (1).