OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Il1f8 (NM_027163) Mouse Untagged Clone

Be the first to review this product
SKU
MC210986
Il1f8 (untagged) - Mouse interleukin 1 family, member 8 (Il1f8), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Il1f8 or NM_027163"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Il1f8
Synonyms 2310043N20Rik; Il36b
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC210986 representing NM_027163
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGGCTTTCCCTCCACAATCTTGTGTACATGTTCTTCCTCCAAAGAGTATTCAAATGTGGGAACCGA
ATCATAACACTATGCATGGATCCTCACAATCTCCCAGAAACTACAGGGTTCATGACTCACAACAGATGGT
ATGGGTCCTGACTGGAAATACTTTAACAGCAGTTCCTGCTAGCAACAATGTCAAGCCTGTCATTCTTAGC
TTGATAGCATGTAGAGACACGGAATTCCAAGATGTAAAGAAAGGTAATCTAGTTTTCCTGGGAATCAAGA
ACAGAAATCTCTGCTTCTGCTGTGTTGAGATGGAGGGCAAACCAACTTTGCAGCTTAAGGAAGTAGACAT
CATGAATTTGTACAAAGAGAGAAAAGCACAAAAAGCCTTTCTGTTCTATCATGGCATAGAGGGCTCCACT
TCTGTCTTTCAGTCAGTCCTCTATCCTGGCTGGTTTATAGCCACCTCTTCCATAGAAAGACAGACAATCA
TCCTCACACATCAGCGGGGTAAATTGGTTAACACTAACTTCTACATAGAGTCTGAGAAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_027163
Insert Size 552 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_027163.4, NP_081439.1
RefSeq Size 790 bp
RefSeq ORF 552 bp
Locus ID 69677
UniProt ID Q9D6Z6
Cytogenetics 2 16.21 cM
Summary Cytokine that binds to and signals through the IL1RL2/IL-36R receptor which in turn activates NF-kappa-B and MAPK signaling pathways in target cells linked to a pro-inflammatory response. Part of the IL-36 signaling system that is thought to be present in epithelial barriers and to take part in local inflammatory response; similar to the IL-1 system with which it shares the coreceptor IL1RAP. Stimulates production of interleukin-6 and interleukin-8 in synovial fibrobasts, articular chondrocytes and mature adipocytes. Induces expression of a number of antimicrobial peptides including beta-defensin 4 and beta-defensin 103 as well as a number of matrix metalloproteases (By similarity). Seems to be involved in skin inflammatory response by acting on keratinocytes, dendritic cells and indirectly on T-cells to drive tissue infiltration, cell maturation and cell proliferation. Induces the production of proinflammatory cytokines in bone marrow-derived dendritic cells (BMDCs), including IL-12, Il-1 beta, IL-6, TNF-alpha and IL-23, and activates p38 MAPK phosphorylation in BMDCs. Involved in dendritic cell maturation by stimulating the surface expression of CD80, CD86 and MHC class II. Induces the production of IFN-gamma, IL-4 and IL-17 by T-helper 1 (Th1) cells, cultured CD4(+) T-cells and splenocytes.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_027163" in other vectors (4)
SKU Description Size Price
MG220215 Il1f8 (tGFP-tagged) - Mouse interleukin 1 family member 8 (Il1f8), (10ug) 10 ug
$500.00
MR220215 Il1f8 (Myc-DDK-tagged) - Mouse interleukin 1 family, member 8 (Il1f8) 10 ug
$289.00 $300.00
MR220215L3 Lenti ORF clone of Il1f8 (Myc-DDK-tagged) - Mouse interleukin 1 family, member 8 (Il1f8) 10 ug
$600.00
MR220215L4 Lenti ORF clone of Il1f8 (mGFP-tagged) - Mouse interleukin 1 family, member 8 (Il1f8) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products