2310061I04Rik (NM_001033630) Mouse Untagged Clone

CAT#: MC210979

2310061I04Rik (untagged) - Mouse RIKEN cDNA 2310061I04 gene (2310061I04Rik), (10ug)

USD 402.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name 2310061I04Rik (NM_001033630) Mouse Untagged Clone
Symbol 2310061I04Rik
Synonyms RP24-180B11.5
Vector pCMV6-Entry
Sequence Data
>MC210979 representing NM_001033630
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTACCGTCCGAGCCCGGGGGCCGCCCGGCGCCTCGGGCCCTGCCTCCGCGCCTACCAGGCGCGACCCC
AGGACCAGCTCTCTCCTCGACCTCTACCATTCCCCCCGCTCTGGCCCCACTCCACTCCACCGACTTCTCC
ATCTTTTCCTCCTCACCGGTCACTACCACCCTCACATCCTCCTACCCACCATCTTCCCCAGGCTCCTCCA
CCACCTCTCTCTCAGGCCCAGGCTCTCAACTCATTGAGTATGGTTCTTCCTCCGAGAAAGAGGGAGAAGG
GACCAGGACCGGAACTACACAGTGGTTGCCTGGATGGGCTTAGGAGCCTTTTTGAGGGACCGCCTTGCCC
CTATCCTGGGGCTGTGATACCTTTCCAAGCCCCTGGACCTTCCCACTCTTCCCCCACCACTCCATCAGGA
GATGAGAGTATGGAGGAACACCTGGCTGTCATGCATGAGAGACTAAGACAAGAGCTTCCCACCCTCTTCC
TTCGCTCCCATGACTACACTATATATTCAATGGATGTGGAATTCATCAATGAGATCCTGAACATTCGTAC
CAAGGGCCGGACATTTTATGTTATGTCCCTGACCCTTTGCCGCTTCCTGGTTTGGAACTATTTTGCACAG
TTTCGGTTGGAGATTTTACAGCTGACCCGCCACCCTGAGAACTGGACCCTGCAAGCCCGCTGGCGTCTAA
TAGGTCTGCCCATACATATGCTCTTCCTGCGTTTCTACAGGCGTGATAAAGAGGATCTTTACCGGACCTT
CGATGCCTTTTCCACCTTCTACCTGAATTCCAGTGGCCTCATCTGTCGCCATCACCTGGACAAGCTGATG
CCTTCACACTCACCGTCGACGCCTGTGAAAAAGCTGCTGGTGGGAGCCCTGGTGGCCCTGGGGCTGTCAG
AACCAGAGCCCAGCTTACACCTGTGCTCCAAGGCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001033630
ORF Size 948 bp
Insert Size 948
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001033630.1, NP_001028802
RefSeq Size 1252
RefSeq ORF 948
Locus ID 69662
Cytogenetics 17|17 B1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.