Mlip (NM_027150) Mouse Untagged Clone

CAT#: MC210975

Mlip (untagged) - Mouse RIKEN cDNA 2310046A06 gene (2310046A06Rik), (10ug)

USD 402


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Mlip (NM_027150) Mouse Untagged Clone
Symbol Mlip
Synonyms 2310046A06Rik; AI931782; CIP
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC210975 representing NM_027150
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAATTTGGAAAGCATGAACCAGGAAGCTCACTAAAGAGGAACAAGAACTTAGAGGAGGGAGTGACGT
TTGAGTACAGTGATCATATGACCTTCAGCTCTGAGAGCAAACAAGAGAGGGTCCAGAGGATACTGGATTA
TCCGTCAGAGGTCAGTGGGAGGAATTCACAACAAAAGGAATTCAATACAAAGGAACCTCAAGGAATGCAG
AAAGGTGATCTCTTCAAAGCAGAATATGTTTTTATTGTGGATTCTGATGGGGAAGATGAAGCTACATGCA
GACAAGGTGAACAAGGCCCCCCAGGGGGACCAGGCAACATAGCTACTCGGCCCAAGTCTCTGGCTATTTC
TTCTAGTCTGGCTTCTGACGTGGTGCGTCCCAAAGTACGAGGGGCTGATCTCAAGACCTCATCACATCCT
GAAATTCCTCATGGGATAGCCCCTCAGCAAAAGCATGGGCTGGCACTAGATGAACCAGCCAGGACTGAAA
GCAACTCCAAGGCCAGCGTGTTAGACCTACCAGTGGAGCATTCTTCTGATTCTCCTTCACGGCCCCCACA
GACAATGTTGGGTTCTGAAACAATCAAAACTCCTACAACTCATCCAAGAGCAGCTGGTCGAGAAACCAAA
TACGCAAATCTTTCTTCATCATCCTCAACAGCGTCTGAGAGCCAACTGACTAAGCCTGGAGTAATTCGTC
CAGTACCTGTAAAATCCAAACTACTCCTGAGAAAGGATGAAGAAGTTTATGAGCCCAACCCTTTCAGTAA
ATACCTTGAAGACAACAGTGGCCTGTTTTCTGAGCAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_027150
ORF Size 810 bp
Insert Size 810
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_027150.1, NP_081426
RefSeq Size 1224
RefSeq ORF 810
Locus ID 69642
Cytogenetics 9|9 D
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.