Efcab9 (NM_027031) Mouse Untagged Clone

CAT#: MC210889

Efcab9 (untagged) - Mouse EF-hand calcium binding domain 9 (Efcab9), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Efcab9
• Synonyms: 1700007I06Rik; 4930403C08Rik
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210889 representing NM_027031
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAAACTGACTCCGGGGTGTTTTCTGTGGTACCTTTACATGGACAAAATCTACTGCTTACTGTCTTTGA
  GAAACGTGAAAGCCTTGATGGTGTACTTTCATCTTCTGGATGTGCACCACAGGAACACCTTGAATGATGT
  GCTCTTCTTTCATTTCCTCCAGCACGTGACTAACCTGAACAAGTCACAGATCGGGATGATATTTGACCTC
  CTGGACTGGACAGCTGTAGGAGAGATTGGTTTTGACCAGTTCTATGTGTTGATTTGCATACTGCTGGCAC
  ATCAGGACCATCTGGAAGACCACTTTATGTACCGCCATTCCCGGCCAGTCTTTGAGCTGCTTGATCTGGA
  CGGGGAGATGAATATAGGTGCGGCCAATTTCCAAAACTACAGATTTCTCTTCAATATTAAAAAGCAGGAA
  CTCCGAGACCTTTTCCATGACTTTGACATCACAGGTGACCGACTGCTTAATTACAAGGAATTTAAGCTGT
  ACACAATCTTCTGCACCGACAAATCCATAGACAGAAAGAAAAGGAGGAAAGACAGAGAGGCAGCGAGAGA
  GAGAGAAAAAGAGAAAGGGAAAGATAAAGAGAAGTATCTTCATCTCAAGAAGATATATTCATCTATGTTA
  AGCCACAGGAGTATCCTGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_027031
• Insert Size: 651 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_027031.3, NP_081307.2
• RefSeq Size: 767 bp
• RefSeq ORF: 651 bp
• Locus ID: 69306
• UniProt ID: Q9DAM2
• Cytogenetics: 11 A4
• Gene Summary: pH-dependent Ca(2+) sensor required to activate the CatSper channel, a complex involved in sperm cell hyperactivation (PubMed:31056283). Sperm cell hyperactivation is needed for sperm motility which is essential late in the preparation of sperm for fertilization (PubMed:31056283). Associates with the CatSper complex via direct interaction with CATSPERZ, and senses intracellular Ca(2+) (PubMed:31056283). Together with CATSPERZ, associates with the CatSper channel pore and is required for the two-row structure of each single CatSper channel (PubMed:31056283).[UniProtKB/Swiss-Prot Function]