Glipr1l1 (NM_027018) Mouse Untagged Clone

SKU
MC210884
Glipr1l1 (untagged) - Mouse GLI pathogenesis-related 1 like 1 (Glipr1l1), (10ug)
  $330.00
3 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Glipr1l1
Synonyms 1700011E04Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC210884 representing NM_027018
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCCTGAAGAAGAAACTTAATTTTTTATGGACATTAGTTCTGTATTTGATAGCCAGCAGACTGCCCA
AGGCATTCGGCAAAGATCTTCCTAGGGTGCCAACTATCACGGATCCGAAATTTATAGATGCATTCCTCAA
CATCCACAATGAACTGCGACGCAAGGTCCAGCCCCCGGCAGCTGATATGAATCAACTGTTTTGGGACCAG
CAGCTGGCAAAACTAGCGAAAGCATGGACTAGAGAGTGCAAACTTGCCCATAATCCCTGTATCAAACAAC
GATACGAATGTCTTGAGGACTATGACTTTATTGGAGAAAATATTTATTTGGGTAGAATTGAAACCCAACC
AGAAGATGTTGTTATTAATTGGTATAATGAAAGTAAATATTTTAATTTTGATTTTAATACCTGTTCTGAA
ATGTGTGGCCATTATACACAGGTAGTTTGGGCCAAAACGGTTAAAATTGGTTGTGCAGTTTCAAATTGTC
CTAATCTCAAGGGCTTTTCAGCTGGGCTATTTGTATGTAATTATTCGCCAGCAGGAAACTTTATAGGCTT
CAGACCTTACACGAGAGGAGACTCTTGCTCTATGTGTGGACAAAAGACGTGTGAGAATAGTCTCTGCCGT
CCCATGAATCGGAAGACACCTCACCACAAAGCGGCATGCCATGTACTTGTGCTTGGTTTTATTCTTCAGA
GCCTACTTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_027018
Insert Size 711 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_027018.1, NP_081294.1
RefSeq Size 899 bp
RefSeq ORF 711 bp
Locus ID 69286
UniProt ID Q9DAG6
Cytogenetics 10 D2
Summary Plays a role in the binding between sperm and oocytes (PubMed:20219979). Component of epididymosomes, one type of membranous microvesicules which mediate the transfer of lipids and proteins to spermatozoa plasma membrane during epididymal maturation. Also component of the CD9-positive microvesicules found in the cauda region.UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_027018" in other vectors (4)
SKU Description Size Price
MG222944 Glipr1l1 (tGFP-tagged) - Mouse GLI pathogenesis-related 1 like 1 (Glipr1l1), (10ug) 10 ug
$500.00
MR222944 Glipr1l1 (Myc-DDK-tagged) - Mouse GLI pathogenesis-related 1 like 1 (Glipr1l1) 10 ug
$289.00 $300.00
MR222944L3 Lenti ORF clone of Glipr1l1 (Myc-DDK-tagged) - Mouse GLI pathogenesis-related 1 like 1 (Glipr1l1) 10 ug
$600.00
MR222944L4 Lenti ORF clone of Glipr1l1 (mGFP-tagged) - Mouse GLI pathogenesis-related 1 like 1 (Glipr1l1) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products