Fam57b (NM_001146347) Mouse Untagged Clone
CAT#: MC210827
Fam57b (untagged) - Mouse family with sequence similarity 57, member B (Fam57b), transcript variant 3, (10ug)
"NM_001146347" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Fam57b |
Synonyms | 1500016O10Rik; A330104J06Rik; AI413816; AW060769 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210827 representing NM_001146347
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCTCCACAGCTGGCTACATAGTCTCCACTTCCTGCAAGCACATCATAGATGACCAGCACTGGCTGT CCTCGGCCTATACACAGTTTGCAGTTCCCTACTTCATCTATGACATCTATGCCATGTTCCTCTGCCACTG GCACAAGCACCAGGTTAAAGGGCACGGAGGGGAAGACGGGACGCCCAGAGCCCTGGGCAGCACCTGGGCT GTGGTACGCGGCTACCTGCACAAGGAGTTCCTCATGGTGCTCCACCACGCGGCCATGGTACTGGTGTGCT TCCCACTCTCAGTGGTGTGGCGACAAGGCAAGGGAGATTTCTTTCTAGGCTGCATGTTGATGGCCGAGGT CAGCACTCCTTTCGTCTGCCTGGGCAAGATCCTCATTCAGTACAAGCAGCAGCACACGTTGCTGCACAAG GTGAACGGAGCCCTGATGCTACTCAGCTTCCTGTGCTGCCGGGTGCTGCTCTTCCCCTACCTGTACTGGG CCTACGGGCGCCACGCTGGCCTGCCCCTGCTCTCAGTGCCCATGGCCATCCCGGCCCACGTCAACCTGGG CGCCGCACTGCTCCTCGCACCCCAGCTCTACTGGTTCTTCCTCATTTGCCGCGGGGCCTGCCGCCTCTTC CGACCCCGAGGCTCCCCACCACCCTCTCCTTGTCAGACCCAGGACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001146347 |
Insert Size | 678 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001146347.1, NP_001139819.1 |
RefSeq Size | 1781 bp |
RefSeq ORF | 678 bp |
Locus ID | 68952 |
UniProt ID | Q7TNV1 |
Cytogenetics | 7 F3 |
Gene Summary | Involved in ceramide synthesis. In vitro, isoform 3 stimulates the production of C16-, C18- and C20-ceramides, isoform 1 slightly increases the levels of C18- and C20-ceramides, while isoform 2 exhibits only minimal activity. May interfere with adipogenesis by stimulating ceramide synthesis.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) includes an alternate exon in the 5' UTR and 5' coding region and uses a downstream start codon, compared to variant 1. It encodes isoform 3, which has a shorter N-terminus than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG214570 | Fam57b (tGFP-tagged) - Mouse family with sequence similarity 57 member B (Fam57b) transcript variant 3, (10ug) |
USD 530.00 |
|
MR214570 | Fam57b (Myc-DDK-tagged) - Mouse family with sequence similarity 57, member B (Fam57b), transcript variant 3 |
USD 330.00 |
|
MR214570L3 | Lenti ORF clone of Fam57b (Myc-DDK-tagged) - Mouse family with sequence similarity 57, member B (Fam57b), transcript variant 3 |
USD 630.00 |
|
MR214570L4 | Lenti ORF clone of Fam57b (mGFP-tagged) - Mouse family with sequence similarity 57, member B (Fam57b), transcript variant 3 |
USD 630.00 |
{0} Product Review(s)
Be the first one to submit a review