Zfp467 (NM_001085416) Mouse Untagged Clone

CAT#: MC210816

Zfp467 (untagged) - Mouse zinc finger protein 467 (Zfp467), transcript variant 3, (10ug)

USD 402.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Zfp467 (NM_001085416) Mouse Untagged Clone
Symbol Zfp467
Synonyms 1190001I08Rik; AB041616; AI426952; AV017623; EZI; MNCb-3350; Znf467
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>NM_001085416.1
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGAGAGACCCTGGAGGCCCTGAACTCCTTGGGATTCTCAGTGGGACAGCCAGAGATGGCTCCCCAGA
GTGAGCCCAGGGATGGGTTCAGTAATGCCCAGGAGAAGATGTCATCCAGAGGAGAGAGCACACTGCACTC
CTGCTCAGGGCATGAGACTCCTGGCCAGAAAGAAGGCATCCACACAGAACAAGCTGAAGCTCCTTGTATG
GGCAGCCAGGCCAGTACCCCACAGAAGGCCGAACCTGCAGGCTCTGTCCCAGTCCTTTTCCCACTCCTGA
CTTGGGTCAGTTGGCTGTTACGTACAAACTGGAGCCAGGGACTCCGGGAGCACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001085416
ORF Size 336 bp
Insert Size 336
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001085416.1, NP_001078885
RefSeq Size 3179
RefSeq ORF 336
Locus ID 68910
Cytogenetics 6|6 B2.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.