Ifitm1 (NM_001112715) Mouse Untagged Clone

CAT#: MC210782

Ifitm1 (untagged) - Mouse interferon induced transmembrane protein 1 (Ifitm1), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ifitm1
• Synonyms: 1110036C17Rik; DSPA2a; Mil-2; Mil2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210782 representing NM_001112715
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCCTAAGGAGCAGCAAGAGGTGGTTGTACTGGGGTCACCCCACATCTCAACTTCTGCGACAGCCACCA
  CAATCAACATGCCTGAGATCTCCACGCCTGACCATGTGGTCTGGTCCCTGTTCAATACACTCTTCATGAA
  CTTCTGCTGCCTGGGCTTCGTAGCCTATGCCTACTCCGTGAAGTCTAGGGACAGGAAGATGGTGGGTGAT
  ACGACTGGGGCCCAGGCCTTCGCCTCCACCGCCAAGTGCCTGAACATCAGCTCCCTGTTCTTCACCATCC
  TCACGGCCATCGTCGTCATCGTTGTCTGTGCCATTAGATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001112715
• Insert Size: 321 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001112715.1, NP_001106186.1
• RefSeq Size: 702 bp
• RefSeq ORF: 321 bp
• Locus ID: 68713
• UniProt ID: Q9D103
• Cytogenetics: 7 F5
• Gene Summary: IFN-induced antiviral protein which inhibits the entry of viruses to the host cell cytoplasm, permitting endocytosis, but preventing subsequent viral fusion and release of viral contents into the cytosol. Active against multiple viruses, including influenza A virus, SARS coronavirus (SARS-CoV), Marburg virus (MARV), Ebola virus (EBOV), Dengue virus (DNV) and West Nile virus (WNV). Can inhibit: influenza virus hemagglutinin protein-mediated viral entry, MARV and EBOV GP1,2-mediated viral entry and SARS-CoV S protein-mediated viral entry. Also implicated in cell adhesion and control of cell growth and migration. Plays a key role in the antiproliferative action of IFN-gamma either by inhibiting the ERK activation or by arresting cell growth in G1 phase in a p53-dependent manner. Acts as a positive regulator of osteoblast differentiation.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) represents the longest transcript and encodes the longer isoform (a). Variants 1, 2, and 3 all encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.