Ecscr (NM_001033141) Mouse Untagged Clone

CAT#: MC210742

Ecscr (untagged) - Mouse endothelial cell-specific chemotaxis regulator (Ecscr), (10ug)

  View "NM_001033141" in other vectors (6)

USD 410.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Ecscr (NM_001033141) Mouse Untagged Clone
Symbol Ecscr
Synonyms 1110006O17Rik; ARIA
Vector pCMV6-Entry
Sequence Data
>MC210742 representing NM_001033141
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTTCGAGACATTTCTCTGGAAGCCCACGGGCTGGGGTCAACACTGACACCCCTTCTTGCCCATCAAC
TCCCACAGGGGAGAGTCAGAGGCTACAGCTCTCAACCTACGACAACTCAGACCTCGCAGGAAATTCTACA
GAAGTCTTCTCAGGTCTCCTTGGTATCCAATCAGCCTGTGACACCAAGGTCAAGCACCATGGATAAACAG
TCCCTTTCCTTGCCTGACTTGATGTCCTTCCAGCCACAGAAGCACACACTGGGACCTGGCACAGGAACCC
CAGAAAGGAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGGAGAGGAGAAGCATCTCTGGATGCTACTCC
CAGTCCAGAAACCACCAGCCTTCAGACAAAAAAGATGACCATCCTGCTGACCATCCTGCCTACCCCCACA
TCAGAGTCAGTGCTAACTGTGGCTGCCTTTGGTGTCATCAGCTTCATTGTCATCCTGGTGGTTGTAGTGA
TCATCCTGGTCAGTGTGGTCAGTCTAAGATTTAAGTGTCGGAAGAACAAGGAGTCTGAAGATCCACAGAA
ACCAGGGAGTTCAGGGCTGTCTGAAAGCTGCTCCACAGCCAATGGAGAGAAAGACAGCATCACACTCATC
TCCATGAGGAACATCAACGTGAACAACAGCAAAGGCAGCATGTCAGCAGAGAAGATTCTTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001033141
ORF Size 693 bp
Insert Size 693
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001033141.1, NP_001028313
RefSeq Size 1111
RefSeq ORF 693
Locus ID 68545
Cytogenetics 18|18 B2

Other Versions

Other products for "Ecscr"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies