Ucma (NM_001165932) Mouse Untagged Clone

CAT#: MC210738

Ucma (untagged) - Mouse upper zone of growth plate and cartilage matrix associated (Ucma), transcript variant 3, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ucma
• Synonyms: 1110017I16Rik; AW121955; Grp
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210738 representing NM_001165932
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCCTGGAGACGGGTCATTCTCCTGTCATCTCTCTTGGCCCTGGTGCTCCTGTGTATGCTACAGGAGG
  GGACCAGCGCTTCTGTGGGGAGCAGGCAGGCAGCTGCAGAGGGGGTGCAGGAAGGTGTGAAACAGAAGAT
  TTTCATGCAAGAATCTGATGCCTCCAATTTCCTCAAGAGGCGTGGCAAGCGGTCTCCTAAGTCCCGAGAT
  GAAGTTAATGAGCAGGAAGAGAGGACCCGGGAGGCTGTGGAGCAGTGGCGCCAGTGGCATTATGATGGCC
  TGTATCCTTCCTACCTCTACAACCGCCAAAACATCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001165932
• Insert Size: 318 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001165932.1, NP_001159404.1
• RefSeq Size: 785 bp
• RefSeq ORF: 318 bp
• Locus ID: 68527
• UniProt ID: Q14BU0
• Cytogenetics: 2 A1
• Gene Summary: This gene encodes chondrocyte-specific, highly charged proteins that are abundantly expressed during the early stages of chondrogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein that is secreted into the extracellular matrix. The glutamic acid residues in the encoded protein undergo gamma carboxylation in a vitamin K-dependent manner. Despite the implied role in calcification and ossification, mice lacking the encoded protein do not display significant defects in the skeletal development. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo a similar proteolytic processing to generate mature proteins. [provided by RefSeq, Aug 2015]
  Transcript Variant: This variant (3, also known as Ucma/GRP-F3) contains an alternate in-frame exon in the 5' coding region and lacks an in-frame exon in the 3' coding region, compared to variant 1. The encoded isoform (c) is shorter than isoform a. This isoform (c) may undergo proteolytic processing similar to isoform b.