Fam133b (NM_001042501) Mouse Untagged Clone

CAT#: MC210698

Fam133b (untagged) - Mouse family with sequence similarity 133, member B (Fam133b), (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Fam133b (NM_001042501) Mouse Untagged Clone
Symbol Fam133b
Synonyms 2900022K02Rik; 5830415L20Rik
Vector pCMV6-Entry
Sequence Data
>MC210698 representing NM_001042501
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGAAACGGGATAATCGCGTGGCCTACATGAATCCAATAGCAATGGCTCGATCAAGGGGTCCAATCC
AGTCTTCAGGACCAACAATCCAGGATTATCTGAATCGACCAAGGCCTACCTGGGAGGAAGTCAAGGAACA
GCTGGAAAAGAAAAAGAAGGGCTCCAAGGCTTTGGCTGAGTTTGAAGAAAAAATGAATGAGAATTGGAAG
AAAGAACTAGAAAAACATAGAGAAAAATTATTAAGTGGAAATGAGAGCTCATCCAAAAAAAGACAGAAAA
AGAAAAAAGAAAAGAAGAAATCTGGTAGGTATTCATCTTCTTCTTCATCGAGCTCTGATTCTTCCAGCAG
TTCTTCAGATTCCGAAGATGAGGATAAAAAACAAACAAAAAGAAGGAAGAAAAAGAAGAGCCGTTGCCAT
AAGTCTCCTGAGAGCTCGGGGTCGGATTCGGCTTCAGACAGCAAGGATGGTTCAAAAAAGAAAAAGAAGT
CCAAGGATGTAACTGAAAGAGAAAAGGACACTAAAGGTCTCAGCAAAAAGAGAAAGATGTACGAAGATAA
ACCGTTGTCATCTGAGTCGCTGTCAGAGTCAGACTGTGGAGAGGTGCAAGCAAAAAGGAAGAAAAGCGGT
GAAGAGCGTGAGAGAACAACAGACAAAGCCAAAAAGAGAAGGAAGCATAAGAAGCACAGCAAGAAGAAGA
AAAAGAAGGCCGCCAGCTCCAGCTCAGACTCGCCGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001042501
ORF Size 738 bp
Insert Size 738
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001042501.1, NP_001035966
RefSeq Size 2304
RefSeq ORF 738
Locus ID 68152
Cytogenetics 5 A1|5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.