Aen (NM_001162939) Mouse Untagged Clone

CAT#: MC210680

Aen (untagged) - Mouse apoptosis enhancing nuclease (Aen), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Aen
• Synonyms: 2700083B06Rik; Isg20l1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210680 representing NM_001162939
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCCGCAAGGCCTTGCTTCAGGAGCAGGAGCTGTTGAGCACGGCACCAGGGCCAGGTCTCTGCCTTC
  TGCCTTCACCATCACAGATGCCAGCGGTCACAGAGGCTTCGGACAGCAGGAGGCAACGTCCCAAGGCCAG
  GTCCGGCAGCAATGGCCTGTGCAGCAAAAAGTCTGTCCCCAGAGAAGCTCCAAGACCTGGGCCCATCAAG
  TGTGTGGCCATTGACTGTGAGATGGTGGGTACGGGCCCCCAAGGACGGGTGAGCGAGCTAGCCCGCTGCT
  CTGTGGTGAGCTACAGTGGTGACGTTCTCTATGACAAATACATCCGGCCTGAAATGCCCATTGTGGACTA
  TCGCACCCGCTGGAGTGGCATCACCCGCCAGCACATGCACAAGGCTATCCCCTTTCAGGTGGCCCAGAAG
  GAGATCCTTAAGCTGTTGAAGGGCAAGGTGGTGGTGGGGCACGCACTGCACAATGACTTCCAGGCCCTGA
  AGTACGTCCACCCTCGGAGCCAGACCCGGGATACCACTTATGTCCCAAACCTGCTCAGCCAGCCCAGCTC
  CCTTATCCGAACTCGGGTCTCTCTTAAGGACCTGGCCTTGAACCTGCTGCACAAGAAGATCCAGGTCGGT
  CACCAGGGCCACTCATCTGTGGAAGATGCCATGACAGCCATGGAGTTGTACCAGCTGGTGGAGGTGCAGT
  GGGAGCAGCAAGTGGCCAGCTCTGCCCAGGCCCCTGCTGAGGACAGGGGGCCCGACAGCAGCACTGACGT
  GGAGCAGTACATGGACGACCAGTACTGGCCCGAGGACCTGACCCAGAGCACCGGGGCCGAGACAAATGGA
  GGCCCAGATAGACAGGAGGGAGAGGAAGGGCAGGGAGCCAGGAGTGCTCCTCCCTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001162939
• Insert Size: 897 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001162939.1, NP_001156411.1
• RefSeq Size: 2466 bp
• RefSeq ORF: 897 bp
• Locus ID: 68048
• UniProt ID: Q9CZI9
• Cytogenetics: 7 D2
• Gene Summary: Exonuclease with activity against single- and double-stranded DNA and RNA. Mediates p53-induced apoptosis. When induced by p53 following DNA damage, digests double-stranded DNA to form single-stranded DNA and amplifies DNA damage signals, leading to enhancement of apoptosis (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 5' UTR and coding region compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.