Lrrc28 (NM_175124) Mouse Untagged Clone

CAT#: MC210640

Lrrc28 (untagged) - Mouse leucine rich repeat containing 28 (Lrrc28), transcript variant 1, (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Lrrc28 (NM_175124) Mouse Untagged Clone
Symbol Lrrc28
Synonyms 1300004K21Rik; 2210012C09Rik; 2310058O11Rik
Vector pCMV6-Entry
Sequence Data
>MC210640 representing NM_175124
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCATCCGAAATCTGTAAGACGATCTCTGTGGCCAGGCTTGAAAAGCACAAGAATTTGTTCTTAAATT
ACAGGAATCTGCACCATTTTCCACTGGAGTTGCTGAAGGATGAGGGGCTGCAGCACCTGGAGAGGCTCTA
TATGAAAAGGAACTCCCTCACAACCTTGCCAGAAAACCTTGCTCAGAAGCTTCCAAACCTTGTGGAACTG
TACCTTCACTCAAATAACATAGTTGTGGTTCCAGAAGCCATCGGGTCCCTCGTGAAACTCCAGTGTCTGG
ATCTCAGTGACAATGCCTTAGAGATCGTTTGCCCAGAAATCGGTGGTCTGAGAGCGTTGCGTCATCTTCG
ATTAGCTAATAACCAGCTACAGTTCCTACCTCCAGAGGTTGGCGATTTGAAGGAGCTGCAGACACTAGAC
ATTTCTAGCAATCGCTTGCTAGCTTTACCCGAGAGGCTTCACCTGTGCCTTTCTCTGCAGTACCTCACTG
TGGACCGCAATCGGCTATGCTGTGTGCCGCGCCATCTCTGCCAGCTGCCCAGCCTCAATGAGCTCTCCAT
GGCTGGAAACCATCTTGCATCTTTGCCCATTGATTTAGGTCGCTCCCGAGAACTGCAGTACGTGTATGTG
GATAACAACATCCAGCTGAAGGGCCTGCCCTCATACCTCTACAACAAAGTCATCGGCTGCAACGGCTGTG
GCATCCCCATCCAATTGTCAGAGGTGAGGCTGCTGACATTTTCATCTGGGCAGCTGACAGTCTTCCTCCC
AGCAGAGGTGAAGACAATAGGCACAGAGAAGGATCATGTCCTGCCTCTGCAAGAACTGACCATGCGGAGT
CTCTACCGCACCTACCACGGGCTTTGGAAAGATCTGAACTTTTTGTCTCCAATCTCATTACCCAGAAGTC
TCCTGGAGCTGCTGCACTGCCCCCTGGGGCACTGTCACCTGTGTAGTGAGCCCATGTTTACCTTCGTCTA
TCCTAAGATCTTCCCCTTGAGAGAGACGCCGATGGCAGGCCTGCACCAGAGGAGGACAAGTATTGGCTTC
GTGGCTTACTGCTGCTCCACCCAGTGTCTGCGGACTTTTAACCTGCTGTGTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_175124
ORF Size 1104 bp
Insert Size 1104
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_175124.5, NP_780333
RefSeq Size 2978
RefSeq ORF 1104
Locus ID 67867
Cytogenetics 7|7 C
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.