2310057J18Rik (NM_026336) Mouse Untagged Clone

CAT#: MC210612

2310057J18Rik (untagged) - Mouse RIKEN cDNA 2310057J18 gene (2310057J18Rik), (10ug)

USD 402.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name 2310057J18Rik (NM_026336) Mouse Untagged Clone
Symbol 2310057J18Rik
Synonyms 2210414P04Rik; Leg1
Vector pCMV6-Entry
Sequence Data
>MC210612 representing NM_026336
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGTCCTGGCTTCCTGGGTCTGGGTACTGGCTGGCTGCTTCTGTGCAGCTGTAGCAGAGGTTTCTG
ATAGCTCAGATCCATATCCTCCTTTATGGGAAGACAGCCCTGAGCAGTTGAGTGACTACATGATGGAGGA
TGGGAACTACATAATTAATCCTTGGGTATACACTGACAGAATGGGGATGTACAGAATCTTACTGGAAGAG
ACAGCTATGTATTTTGCAAAATATGGTCCAGAAAATGAACAAAATCTTCTTTGGGGATTGCCTCTGCAGT
TTGGCTGGCAGTATCAATCAGGTAGATTAGCTGATCCCACTGGAATGACAGACTGTGGCAATGAACTTAA
TGAGAGTCTGTGTGTCTCTGTGGACAGTTGGTGGGCAGATATAAATTATTATCTGAGTGTGATACCTTTC
CTTGCTGCTGTTGATTCTGGAATAACAGGAATATCACCAAACCAAATCACGATCCTGCCTCCACCCAAGG
ATCAGATGAGGTTTTGTTATAATGTTTCTGACTGTCAATCTGCCGTCCCTGGAACAATGAACAGATGGAG
AGACTTTTTTCAGTACATGCAGTTGAATTCCAGTGACTTTGATGGCCTTCTTAACTACTTATGGGAAGCC
CATGCCTCATCCTTGGACTATCCCACCAGTGCCTTTGGAGACAGATATAATTTCTATTCTGAAAAAGAAG
CAAATTTTGAGGAAAACTGGGCTATTGCTGTGAACTATTTAGCGGCAGCCCGTCTTCCTACAACCCAAAA
TAGAACATACAGCTTTCAGAGGGGCCTGCCCCCACGAGTCCTTGTTGATACTGACATAGCCCCTTTTATT
CCTGACTTCACTCCTCTTCAGAACGAAGTCCTGGTATCACTCAAACTTCTTGGTGATACTGACAGAAATT
CAGGATCATTATCTTTGACTCTATGGGAAAATCTCATGAGTACAAAACTTGCAAGAACATTATTTCTAAA
AGCCTTTGAAGAGTTCCTGGCAACATCTTCTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_026336
ORF Size 1014 bp
Insert Size 1014
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_026336.3, NP_080612
RefSeq Size 1319
RefSeq ORF 1014
Locus ID 67719
Cytogenetics 10|10 A4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.