Dnajc19 (NM_026332) Mouse Untagged Clone

CAT#: MC210607

Dnajc19 (untagged) - Mouse DnaJ (Hsp40) homolog, subfamily C, member 19 (Dnajc19), transcript variant 1, (10ug)

USD 402.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Dnajc19 (NM_026332) Mouse Untagged Clone
Symbol Dnajc19
Synonyms 1810055D05Rik; AA959924; Tim14
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC210607 representing NM_026332
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCAGCACAGTGGTAGCAGTCGGGTTGACCATTGCTGCTGCAGGATTTGCAGGCCGTTATGTTTTAC
AAGCCATGAAGCATGTGGAGCCTCAAGTAAAACAAGTTTTTCAGAGCCTACCAAAATCTGCATTCGGTGG
TGGGTACTACAGAGGTGGATTTGAACCCAAAATGACAAAACGGGAAGCAGCATTAATATTAGGTGTAAGC
CCTACTGCCAATAAAGGGAAGATCAGGGATGCTCATCGCCGGATTATGCTATTAAATCACCCAGACAAGG
GAGGATCTCCTTATATAGCAGCCAAAATCAATGAAGCTAAAGACTTACTAGAAGGACAAGCTAAAAAATA
A


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_026332
ORF Size 351 bp
Insert Size 351
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_026332.4, NP_080608
RefSeq Size 686
RefSeq ORF 351
Locus ID 67713
Cytogenetics 3 A3|3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.