OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Dyx1c1 (NM_001163725) Mouse Untagged Clone

Be the first to review this product
SKU
MC210598
Dyx1c1 (untagged) - Mouse dyslexia susceptibility 1 candidate 1 homolog (human) (Dyx1c1), transcript variant 2, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Dyx1c1 or NM_001163725"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Dyx1c1
Synonyms 1700010I24Rik; b2b811.1Clo; b2b811Clo; Dnaaf4; EKN1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC210598 representing NM_001163725
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCAGTGCGAGTGAGCGAGTTCAGCTGGCAGCAGACGCCGGCCACGATCTTCCTGTCGCTGCCTTTGC
GGGGCGTCTGCGTGCGCGATGCTGACGTATTCTGTGGGGAAAGTTACCTGAAGGTTAACTTTCCTCCATT
TTTATTTGAGCTGTTTCTCTATGCTCCTATAGATGATGGGAAGAGCAAAGCCAAGATTGGAAATGACACG
ATTCTTTTCACATTGTATAAAAAGGAGCCAGTTCTGTGGGATAGCCTTTCTGTGCCGGGTGGGAGGAATT
GGGAAAACATATTTCCTGAGAAGTTAAAGGAAGACAGAGTCCCTGCGCCTCGCTCCGCTGGCAGTATTCA
AATCAGCTTTACCCCTCGAGTGTTCCCAACAGCACTTCGGGAATCCCAAGTCGCAGAAGAGGAGGAGTGG
CTGCATAAACAAGCAGAAGCACGGAGAGCCATGAGCACTGACCTTCCTGAGTTCTTTGACTTAAAAGAAG
AAGAGAGGAATCCAGACTGGTTGAAAGACAAGGGAAACAAATTGTTTGCAACAGAAAACTATTTGGCAGC
GGTTGATGCATATAATTTAGCCATACGACTGAACTGTAAGATCCCATTATTGTATTTGAATCGGGCTGCT
TGCCACCTCAAATTAAAAAACCTACACAAGGCCATCGAGGACTCTTCTAAGGCACTAGAGTTATTGACAC
CACCTGTTGCTGACAATGCCAATGCAAGAATGAAGGCACACGTCCGACGAGGGACAGCGTTCTGTCAACT
AGAATTGTATGTTGAAGGCTTGCAAGATTATGAAGCTGCACTTAAGATTGACCCAGCCAACACAGTTGTA
CAGAACGATGCAGAGAAGATTCGGAATATAATTCAAGGGACGGCACTGAAGTCTCGTGACTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI |
ACCN NM_001163725
Insert Size 903 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001163725.1, NP_001157197.1
RefSeq Size 1618 bp
RefSeq ORF 903 bp
Locus ID 67685
Cytogenetics 9 D
Summary Involved in neuronal migration during development of the cerebral neocortex. May regulate the stability and proteasomal degradation of the estrogen receptors that play an important role in neuronal differentiation, survival and plasticity (By similarity). Axonemal dynein assembly factor required for ciliary motility.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) lacks exons in the coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001163725" in other vectors (4)
SKU Description Size Price
MG215836 Dyx1c1 (tGFP-tagged) - Mouse dyslexia susceptibility 1 candidate 1 homolog (human) (Dyx1c1) transcript variant 2, (10ug) 10 ug
$530.00
MR215836 Dyx1c1 (Myc-DDK-tagged) - Mouse dyslexia susceptibility 1 candidate 1 homolog (human) (Dyx1c1), transcript variant 2 10 ug
$330.00
MR215836L3 Lenti ORF clone of Dyx1c1 (Myc-DDK-tagged) - Mouse dyslexia susceptibility 1 candidate 1 homolog (human) (Dyx1c1), transcript variant 2 10 ug
$630.00
MR215836L4 Lenti ORF clone of Dyx1c1 (mGFP-tagged) - Mouse dyslexia susceptibility 1 candidate 1 homolog (human) (Dyx1c1), transcript variant 2 10 ug
$630.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products