Rffl (NM_001164570) Mouse Untagged Clone

CAT#: MC210530

Rffl (untagged) - Mouse ring finger and FYVE like domain containing protein (Rffl), transcript variant 4, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Rffl
• Synonyms: 1700051E09Rik; 4930516L10Rik; BG080975; Carp2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210530 representing NM_001164570
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCACAGCCTAGCCTGTGGAAGGACAGCCATTATTTTATCATGTGGGCATCCTGCTGCAACTGGTTCT
  GCTTGGATGGACAGCCTGAGGAGGCACCACCACCACAGGGAGCCAGGACACAAGCCTATTCCAACCCTGG
  GTACAGCTCCTTCCCTTCCCCCACAGGCTCGGAACCTAGCTGCAAGGCCTGCGGGGTCCATTTCGCAAGC
  ACAACCCGGAAGCAGACCTGCTTGGACTGTAAGAAAAACTTCTGCATGACTTGTTCGAGCCAAGAGGGGA
  ATGGGCCACGCCTCTGCCTTCTCTGCCTACGGTTCCGAGCCACGGCCTTCCAGCGGGAGGAGCTCATGAA
  GATGAAGGTGAAGGACCTGAGGGACTATCTCAGCCTCCACGACATCTCTACGGAAATGTGCCGGGAGAAA
  GAGGAGCTGGTGTTCCTGGTGCTTGGCCAGCAGCCTGTAATTTCTGAGGCGGACAGGACTCGTGTTCCCC
  ACTTGCCCCAGGCCTTCCCTGAGCAGCAGGCCTTCCTGACCCAGCCTCAAACCAGCACAGTGCCTCCTAC
  CTCACCTGGCCTCCCTTCTTCACCTGCACAAGTCACCTCTGTCCCCTTAGCCCAGGATCAGGAAACTCAG
  CAGGCCGTTGGCCATGTGTCTCAGGACCACGAGGAGCCCATCTTCCCGGAGAGCACAGCCAGAGTACCTA
  CTGAGGATGAGACCCAGTCCGTTGACTCAGAGGACAGCTTCGTCCCAGGCCGGAGGGCCTCGCTGTCTGA
  CCTGACCCACCTGGAGGACATTGAAGGCCTGACCGTACGGCAGCTGAAGGAGATCCTGGCTCGTAACTTT
  GTCAACTATAAGGGCTGCTGCGAGAAGTGGGAGCTGATGGAGAGGGTGACTCGGCTGTACAAGGATCAGA
  AAGGACTCCAGCACCTGGTGTCTGGTAATGAAGACCAAAACGGGGGAGCAGTGCCTTCTGGCCTGGAGGA
  GAACCTGTGTAAGATTTGCATGGACTCACCCATTGACTGTGTTCTGCTGGAGTGTGGCCACATGGTGACC
  TGTACCAAGTGTGGCAAACGCATGAACGAATGTCCTATCTGCCGGCAGTATGTGATCAGAGCAGTGCACG
  TCTTCCGGTCCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001164570
• Insert Size: 1134 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001164570.1, NP_001158042.1
• RefSeq Size: 3592 bp
• RefSeq ORF: 1134 bp
• Locus ID: 67338
• UniProt ID: Q6ZQM0
• Cytogenetics: 11 C
• Gene Summary: E3 ubiquitin-protein ligase that regulates several biological processes through the ubiquitin-mediated proteasomal degradation of various target proteins. Mediates 'Lys-48'-linked polyubiquitination of PRR5L and its subsequent proteasomal degradation thereby indirectly regulating cell migration through the mTORC2 complex. Also ubiquitinates the caspases CASP8 and CASP10, promoting their proteasomal degradation, to negatively regulate apoptosis downstream of death domain receptors. Also negatively regulates the tumor necrosis factor-mediated signaling pathway through targeting of RIPK1 to ubiquitin-mediated proteasomal degradation. Negatively regulates p53/TP53 through its direct ubiquitination and targeting to proteasomal degradation. Indirectly, may also negatively regulate p53/TP53 through ubiquitination and degradation of SFN. May also play a role in endocytic recycling.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) differs in the 5' UTR and 5' coding region, and uses an alternate translational start codon, compared to variant 1. The resulting isoform (4) is longer at the N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.