Rffl (NM_001164569) Mouse Untagged Clone

CAT#: MC210527

Rffl (untagged) - Mouse ring finger and FYVE like domain containing protein (Rffl), transcript variant 3, (10ug)


  "NM_001164569" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rffl Antibody - N-terminal region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Rffl"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rffl
Synonyms 1700051E09Rik; 4930516L10Rik; BG080975; Carp2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210527 representing NM_001164569
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATCTCATCCGAACATGGCTCCAGCGACCTCAGCCGCAGCTTCTTCGGGCAGCCCACTGTCTGCTGTG
GCAGTGTTTTGAGACAGGCAAAAGCAGATTTTATCATGTGGGCATCCTGCTGCAACTGGTTCTGCTTGGA
TGGACAGCCTGAGGAGGCACCACCACCACAGGGAGCCAGGACACAAGCCTATTCCAACCCTGGGTACAGC
TCCTTCCCTTCCCCCACAGGCTCGGAACCTAGCTGCAAGGCCTGCGGGGTCCATTTCGCAAGCACAACCC
GGAAGCAGACCTGCTTGGACTGTAAGAAAAACTTCTGCATGACTTGTTCGAGCCAAGAGGGGAATGGGCC
ACGCCTCTGCCTTCTCTGCCTACGGTTCCGAGCCACGGCCTTCCAGCGGGAGGAGCTCATGAAGATGAAG
GTGAAGGACCTGAGGGACTATCTCAGCCTCCACGACATCTCTACGGAAATGTGCCGGGAGAAAGAGGAGC
TGGTGTTCCTGGTGCTTGGCCAGCAGCCTGTAATTTCTGAGGCGGACAGGACTCGTGTTCCCCACTTGCC
CCAGGCCTTCCCTGAGCAGCAGGCCTTCCTGACCCAGCCTCAAACCAGCACAGTGCCTCCTACCTCACCT
GGCCTCCCTTCTTCACCTGCACAAGTCACCTCTGTCCCCTTAGCCCAGGATCAGGAAACTCAGCAGGCCG
TTGGCCATGTGTCTCAGGACCACGAGGAGCCCATCTTCCCGGAGAGCACAGCCAGAGTACCTACTGAGGA
TGAGACCCAGTCCGTTGACTCAGAGGACAGCTTCGTCCCAGGCCGGAGGGCCTCGCTGTCTGACCTGACC
CACCTGGAGGACATTGAAGGCCTGACCGTACGGCAGCTGAAGGAGATCCTGGCTCGTAACTTTGTCAACT
ATAAGGGCTGCTGCGAGAAGTGGGAGCTGATGGAGAGGGTGACTCGGCTGTACAAGGATCAGAAAGGACT
CCAGCACCTGGTGTCTGGTAATGAAGACCAAAACGGGGGAGCAGTGCCTTCTGGCCTGGAGGAGAACCTG
TGTAAGATTTGCATGGACTCACCCATTGACTGTGTTCTGCTGGAGTGTGGCCACATGGTGACCTGTACCA
AGTGTGGCAAACGCATGAACGAATGTCCTATCTGCCGGCAGTATGTGATCAGAGCAGTGCACGTCTTCCG
GTCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001164569
Insert Size 1197 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001164569.1, NP_001158041.1
RefSeq Size 3650 bp
RefSeq ORF 1197 bp
Locus ID 67338
Cytogenetics 11 C
Gene Summary E3 ubiquitin-protein ligase that regulates several biological processes through the ubiquitin-mediated proteasomal degradation of various target proteins. Mediates 'Lys-48'-linked polyubiquitination of PRR5L and its subsequent proteasomal degradation thereby indirectly regulating cell migration through the mTORC2 complex. Also ubiquitinates the caspases CASP8 and CASP10, promoting their proteasomal degradation, to negatively regulate apoptosis downstream of death domain receptors. Also negatively regulates the tumor necrosis factor-mediated signaling pathway through targeting of RIPK1 to ubiquitin-mediated proteasomal degradation. Negatively regulates p53/TP53 through its direct ubiquitination and targeting to proteasomal degradation. Indirectly, may also negatively regulate p53/TP53 through ubiquitination and degradation of SFN. May also play a role in endocytic recycling.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) includes an additional segment in the 5' UTR and 5' coding region, and uses an alternate translational start codon, compared to variant 1. The resulting isoform (3) is longer at the N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.