Nde1 (NM_001114085) Mouse Untagged Clone

CAT#: MC210502

Nde1 (untagged) - Mouse nuclear distribution gene E homolog 1 (A nidulans) (Nde1), transcript variant b, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Nde1
• Synonyms: 2810027M15Rik; AU042936; AW822251; mNudE; Nude
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210502 representing NM_001114085
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGGACTCGGGAAAGACCTTTGAATCAGAGGAGGAAGAAACAAACTATTGGAGAGACCTGGCCATGA
  CCTACAAACAGAGGGCAGAGAATACTCAGGAAGAACTCAGAGAGTTCCAGGAAGGAAGCCGAGAATACGA
  AGCTGAATTGGAGGCTCAGCTGCAGCAGATTGAAACCAGGAACCGGGACCTCTTGTCAGAGAATAACCGC
  CTTCGCATGGAGCTGGAGTCTGTGAAGGAGAAGTTTGAGATGCAGCACTCAGAGGGTTACCGGCAGATCT
  CAGCCTTGGAGGATGACCTGGCGCAGACGAAAGCCATTAAAGACCAACTGCAGAAATACATTAGGGAACT
  GGAACAAGCCAATGATGACCTGGAAAGAGCCAAACGAGCCACAATCATGTCCCTGGAAGACTTTGAGCAG
  CGTTTGAATCAAGCCATTGAAAGAAATGCCTTCCTAGAGAGTGAGCTGGATGAGAAGGAGAATCTTCTAG
  AATCTGTGCAGAGGCTGAAGGATGAAGCCCGAGATCTGCGGCAGGAATTGGCTGTGCAACAGAAGCAAGA
  CAAGCCCCGGACACCCATGCCAGGCTCAGGGCAAGCCAAGAGGACAGACATGGCTGTGCAGGCCACAGGC
  TCTGTACCGTCTACTCCAGTAGCTCACCGAGGACCTAGCTCTGGTTTGAACACACCAGGAATGTTCAGAC
  GTGGTCTGGACAGCTCCACTAGTGGGACGCCACTCACACCTGCAGCCCGGATATCAGCCCTAAACATCGT
  TGGGGACCTGCTTCGGAAAGTTGGGGCCCTGGAGTCCAAGCTAGCATCATGCAGGAACTTCATGTATGAT
  CAGTCCCCAAGCCGGACAAGTGGGCCAGCCTCAGGACGAGGAACCAAAAACAGAGATGGTGTTGACAGAA
  GGCCAGGCAGTACCAGTGTGGGCGATAAAGGATCCCTTCCCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001114085
• Insert Size: 954 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001114085.1, NP_001107557.1
• RefSeq Size: 1682 bp
• RefSeq ORF: 954 bp
• Locus ID: 67203
• UniProt ID: Q9CZA6
• Cytogenetics: 16 A1
• Gene Summary: Required for centrosome duplication and formation and function of the mitotic spindle. Essential for the development of the cerebral cortex. May regulate the production of neurons by controlling the orientation of the mitotic spindle during division of cortical neuronal progenitors of the proliferative ventricular zone of the brain. Orientation of the division plane perpendicular to the layers of the cortex gives rise to two proliferative neuronal progenitors whereas parallel orientation of the division plane yields one proliferative neuronal progenitor and a post-mitotic neuron. A premature shift towards a neuronal fate within the progenitor population may result in an overall reduction in the final number of neurons and an increase in the number of neurons in the deeper layers of the cortex.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (b) uses an alternate splice site in the 3' coding region which results in a frameshift, compared to variant a. The encoded isoform (b) has a shorter and distinct C-terminus compared to isoform a.