Rnaseh2b (NM_026001) Mouse Untagged Clone

CAT#: MC210498

Rnaseh2b (untagged) - Mouse ribonuclease H2, subunit B (Rnaseh2b), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Rnaseh2b
• Synonyms: 1110019N06Rik; 2610207P08Rik; Dleu8
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210498 representing NM_026001
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCGGAGGTCGGGACCGCGGGGACTTGGCGGCCAGGCAGCTAGTGTTCCTACTTCCAGAACATTTAA
  AAGATGCCTCGAAGAAGAAGAAGAAGAGCAGCCTCCTGTTCGTAAAGCTGGCCAACCCGCACTCAGGGGA
  AGGAGCCACATACTTAATTGATATGTGTCTTCAACAGCTGTTTGAAATAAAAGTTTTCAAGGAAAAACAC
  CATTCTTGGTTTATAAATCAATCAGTTCAATCAGGGGGCCTTCTCCACTTTGCCACACCCATGGATCCAT
  TGTTCCTGCTCCTTCACTATCTCCTAAAGGCTGGCAAAGAGGGGAAGTATCAGCCCTTGGACCAAGTCGT
  GGTCGATGACACGTTTCCAGATTGCACCTTGCTGCTGAGATTTCCTGAGCTTGAAAAGTCACTTCGGCAT
  GTGACAGAGGAAAAAGAAGTGAACAGCAAGAAGTACTATAAGTACAGCTCAGAGAAGACATTGAAGTGGC
  TGGAGAAGAAGGTCAACCAAACTGTGGTGGCACTAAAAGCTAATAATGTCAATGTTGGAGCCCGGGTTCA
  GTCATCTGCATATTTCTCTGGTGGTCAGGTTTCCAGGGACAAGGAAGAGGATTATGTTCGCTATGCCCAT
  GGTCTGATCTCTGATTACATCCCTAAAGAACTGAGTGATGATTTATCCAAGTTCTTGAAGCTTCCAGAAC
  CTCCAGCTTCATTGACCAACCCTCCATCAAAGAAACTAAAGTTATCAGATGAGCCTGTAGAAGCCAAAGA
  AGATTACACTAAGTTTAACACTAAAGACTTGAAGACCGGCAAGAAAAATAGCAAAATGACTGCAGCTCAG
  AAGGCTTTGGCTAAAGTTGACAAAAGTGGAATGAAAAGTATCGATGCCTTTTTTGGTGCAAAAAATAAAA
  AAACTGGAAAGATTTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_026001
• Insert Size: 927 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_026001.2, NP_080277.1
• RefSeq Size: 1457 bp
• RefSeq ORF: 927 bp
• Locus ID: 67153
• UniProt ID: Q80ZV0
• Cytogenetics: 14 D1
• Gene Summary: Non catalytic subunit of RNase H2, an endonuclease that specifically degrades the RNA of RNA:DNA hybrids. Participates in DNA replication, possibly by mediating the removal of lagging-strand Okazaki fragment RNA primers during DNA replication. Mediates the excision of single ribonucleotides from DNA:RNA duplexes.[UniProtKB/Swiss-Prot Function]