Dynlrb1 (NM_025947) Mouse Untagged Clone
CAT#: MC210480
Dynlrb1 (untagged) - Mouse dynein light chain roadblock-type 1 (Dynlrb1), (10ug)
"NM_025947" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Dynlrb1 |
Synonyms | 2010012N15Rik; 2010320M17Rik; 9430076K19Rik; AV124457; Dncl2a; DNLC2A; km23-1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210480 representing NM_025947
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGAGGTGGAGGAAACACTCAAGAGGCTTCAGAGCCAGAAAGGAGTGCAGGGCATCATCGTGGTGA ACACAGAAGGCATTCCCATCAAGAGCACAATGGACAATCCCACCACTACACAGTATGCCAACCTCATGCA CAACTTCATCTTGAAGGCGCGGAGCACTGTGCGTGAGATTGACCCCCAAAACGACCTAACCTTCCTTCGA ATTCGCTCCAAGAAAAATGAAATTATGGTGGCACCAGATAAAGACTATTTCCTGATTGTGATCCAGAATC CAACTGAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_025947 |
Insert Size | 291 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_025947.3, NP_080223.2 |
RefSeq Size | 702 bp |
RefSeq ORF | 291 bp |
Locus ID | 67068 |
UniProt ID | P62627 |
Cytogenetics | 2 H1 |
Gene Summary | Acts as one of several non-catalytic accessory components of the cytoplasmic dynein 1 complex that are thought to be involved in linking dynein to cargos and to adapter proteins that regulate dynein function. Cytoplasmic dynein 1 acts as a motor for the intracellular retrograde motility of vesicles and organelles along microtubules.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) contains an alternate 5' terminal exon, and it thus differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (b) has a distinct N-terminus and is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222083 | Dynlrb1 (tGFP-tagged) - Mouse dynein light chain roadblock-type 1 (Dynlrb1), (10ug) |
USD 350.00 |
|
MR222083 | Dynlrb1 (Myc-DDK-tagged) - Mouse dynein light chain roadblock-type 1 (Dynlrb1) |
USD 150.00 |
|
MR222083L3 | Lenti ORF clone of Dynlrb1 (Myc-DDK-tagged) - Mouse dynein light chain roadblock-type 1 (Dynlrb1) |
USD 450.00 |
|
MR222083L4 | Lenti ORF clone of Dynlrb1 (mGFP-tagged) - Mouse dynein light chain roadblock-type 1 (Dynlrb1) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review