Tbc1d7 (NM_025935) Mouse Untagged Clone

CAT#: MC210476

Tbc1d7 (untagged) - Mouse TBC1 domain family, member 7 (Tbc1d7), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tbc1d7
• Synonyms: 2610009C09Rik
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210476 representing NM_025935
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGACTGACGACTCTCAGAGGAACTTTCGATCAGTCTACTATGAGAAAGTCGGGTTTCGTGGTGTCGAAG
  AAAAGAAATCACTGGAAATCCTCCTGAAAGATGACCGTTTGGACATCGAGAAGCTTTGCACATTTAGCCA
  GAGGTTCCCTCTCCCATCCATGTATCGCGCGTTGGTATGGAAGGCGCTTCTAGGCATCTTACCTCCGCAC
  CATGACACTCATTCCCAGGTGATGGCCTACCGCAAAGACCAGTACCATGACATCCTCCATGCCCTGACAG
  TCGTCCGCTTCATCAGTGATGCCACGCCACAGGCTGAAGTGTATCTTCGCATGTATCAGCTTGAATCGGG
  GAAGCTACCTCGAAGTCCCTCTTTTCCTCTGGAGCCGGAGGATGAAGTCTTTCTTGCCATCGCCAAGGCC
  ATGGAAGAGATGGTGGAAGACAGTGTGGACTGTTACTGGATCAGCCGATGCTTCGTGAAGCAGTTAAATA
  ACAAGTACAGGGACGCTTTACCTCAGCTGCCCAAGGCTTTCGAGCAGTACTTGAATCTGGAAGACAGTAG
  GCTGCTGAGTCACCTGAAGACGTGTTCTGCAGTGTCCAAACTGCCTTACGACCTCTGGTTCCAAAGGTGC
  TTCGCGGGATGCCTCCCCGAGTCCAGTTTACAGAGGGTCTGGGATAAAGTCGTAAGTGGATCCTGTAAGA
  TCCTAGTTTTTGTAGCGGTAGAAATACTATTAACCTTTAAAATAAAGGTCATGGCATTGAACAGTGCAGA
  GAAGATAACGAAGTTCCTGGAAAATATTCCTCAGGACAGCTCAGATGCCATCGTGAGCAAGGCCATCGAC
  TTGTGGCACAAACACTGTGGGACCCCAGTGCATTCGGCCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_025935
• Insert Size: 882 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_025935.3, NP_080211.1
• RefSeq Size: 1248 bp
• RefSeq ORF: 882 bp
• Locus ID: 67046
• UniProt ID: Q9D0K0
• Cytogenetics: 13 A4
• Gene Summary: Component of the TSC-TBC complex, that contains TBC1D7 in addition to the TSC1-TSC2 complex and consists of the functional complex possessing GTPase-activating protein (GAP) activity toward RHEB in response to alterations in specific cellular growth conditions. The small GTPase RHEB is a direct activator of the protein kinase activity of mTORC1 and the TSC-TBC complex acts as a negative regulator of mTORC1 signaling cascade by acting as a GAP for RHEB. Participates in the proper sensing of growth factors and glucose, but not amino acids, by mTORC1. It is unclear whether TBC1D7 acts as a GTPase-activating protein and additional studies are required to answer this question.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) has an alternate splice site in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same isoform (1).