Tmem107 (NM_028336) Mouse Untagged Clone

CAT#: MC210451

Tmem107 (untagged) - Mouse transmembrane protein 107 (Tmem107), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tmem107
• Synonyms: 1110004B13Rik; 2810049P21Rik
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210451 representing NM_028336
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGTCGGATCTCCGGGCTCGTGCCCTCTCGGTTCCTGACGCTCTTGGCTCATCTGGTGGTTGTCATCA
  CGTTGTTCTGGTCCCGGGAAAGCAACATCCAGGCTTGCCTGCCTCTCAAATTCACCCCGGAGGAATACGA
  AAAGCAGGACAACCAGCTGGTAGCCGCGCTCTGTCTCACCCTGGGCCTCTTTGCAGTGGAGCTGGCTGGC
  TTCCTCTCAGGAGTCTCCATGTTCAATAGCACCCAGAGCCTCCTCTCCATTGCAGCCCACTGTAGCGCGT
  CTGTGGCCCTGTCTTTCTTCGTATTCGAGCGATGGGAATGTACCACGTACTGGTACATTTTTACCTTCTG
  CAGGTGCCCTAGCACCCAATATTTTGGAATGGGGGGGGGTGGTGGAAAATCGATCCCAAATCTGAAGGTT
  TCCCCCACCTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_028336
• Insert Size: 432 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_028336.3, NP_082612.2
• RefSeq Size: 1281 bp
• RefSeq ORF: 432 bp
• Locus ID: 66910
• UniProt ID: Q9CPV0
• Cytogenetics: 11 B3
• Gene Summary: Plays a role in cilia formation and embryonic patterning. Requires for normal Sonic hedgehog (Shh) signaling in the neural tube and acts in combination with GLI2 and GLI3 to pattern ventral and intermediate neuronal cell types. During ciliogenesis regulates the ciliary transition zone localization of some MKS complex proteins (PubMed:26595381, PubMed:26518474).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) is the longer transcript and encodes the longer isoform (2).