Tmem239 (NM_025753) Mouse Untagged Clone

CAT#: MC210431

Tmem239 (untagged) - Mouse RIKEN cDNA 4933425O20 gene (4933425O20Rik), (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tmem239 (NM_025753) Mouse Untagged Clone
Symbol Tmem239
Synonyms 4933425O20Rik
Vector pCMV6-Entry
Sequence Data
>MC210431 representing NM_025753
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGCAGCCACGAGTGGAGTCGGATATCATCGGGGCTGGCGAGGGGCCCCAGCGGGCAGTGCCCTGGT
CAGCCTGGATCATCCGTCAGGACTGGGTGCGCTGGTGGGTATGCCACATACCTCGGAGCTGGACCCAGTG
GTGGAATACATCAGGCTGGCGGCAACCACTACAGCGGATGCTGTGGGGTCTGGAGGGGACACTCTACCTG
CTGCTGGCACTGATGCTATGTCACGCACTCTTCACCACGGGCTCCTACCTGCTGAGCTCGCTATGGCCCG
TGGTGGCTGTGATGTGGAGCCACCTGCTGCCAGCAATCCTGCTGCTTGTGCTCAGTGCCCTGCCTGCTCT
GCTCTTCGCAGCCTCCTTCCTGCTGCTCTTTTCCACACTGCTGAGCCTCGTGGGCCTGCTCACCTCCATG
ACTCAACCAGGCTACGCTCAGGACTTGGACCAATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_025753
ORF Size 456 bp
Insert Size 456
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_025753.3, NP_080029
RefSeq Size 1170
RefSeq ORF 456
Locus ID 66766
Cytogenetics 2|2 F1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.