Trim13 (NM_023233) Mouse Untagged Clone

CAT#: MC210398

Trim13 (untagged) - Mouse tripartite motif-containing 13 (Trim13), transcript variant 2, (10ug)


  "NM_023233" in other vectors (4)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Trim13"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Trim13
Synonyms 3110001L12Rik; CAR; LEU5; Rfp2; RNF77
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210398 representing NM_023233
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGCTGCTTGAAGAAGACCTCACATGCCCAATTTGCTGCAGTTTGTTTGATGACCCCCGAGTGTTGC
CCTGCTCACACAACTTCTGCAAAAAATGCTTAGAAGGGCTCTTAGAGGGGAATGTGCGGAATTCCCTGTG
GAGACCATCTCCCTTCAAGTGTCCTACCTGCCGTAAGGAAACCTCAGCTACTGGAGTCAACAGTCTGCAG
GTCAATTACTCCCTAAAGGGTATCGTGGAGAAATACAACAAAATCAAGATTTCTCCCAAGATGCCAGTGT
GCAAAGGACATTTGGGGCAGCCTCTCAACATCTTCTGCGTAACTGATATGCAGCTGATTTGTGGGATCTG
TGCTACTCGAGGCGAGCACACCAAGCATGTCTTCTCTTCTATTGAAGATGCCTACGCTCGAGAAAAGAAT
GCCTTTGAGTCCCTCTTTCAGAGTTTCGAGACTTGGCGCCGGGGAGATGCTCTTTCCCGCTTGGATACTT
TGGAAACAAACAAGAGGAAAGCCCTCCAGTTACTCACGAAGGATTCAGATAAAGTAAAGGAGTTTTTTGA
GAAGTTACAGCACACCTTGGATCAAAAGAAGAATGAAATCCTGTCTGACTTTGAAACTATGAAGCTTGCA
GTTATGCAAACCTATGACCCGGAGATCAACAAAATCAACACTATTTTACAGGAGCAGCGGATGGCCTTCA
ACATTGCTGAGGCTTTCAAAGATGTCTCAGAACCTATTATATTTTTGCAACAGATGCAAGAGTTCAGGGA
GAAAATCAAAGTAATCAAGGAAACTCCTTTGCCACACTCTAATTTGCCCACAAGCCCTTTAATGAAGAAC
TTTGATACCAGTCAGTGGGGAGACATTAAACTAGTTGATGTGGATAAACTGTCTTTGCCGCAAGACACAG
GTGTGTTCACTAGCAAGATTCCCTGGTACCCCTATCTGCTGCTCATGATGGTAGTTCTGCTGGGTCTCCT
CATATTCTTTGGCCCCACTGTATTCCTGGAATGGTCTCCACTTGATGAATTGGCAACTTGGAAAGACTAT
CTTTCAAGCTTCAATTCTTACCTGACTAAGTCTGCTGATTTTATAGAACAATCTGTTTTTTACTGGGAAC
AGATGACAGATGGGTTTTTCATTTTTGGTGAAAGAGTAAAAAATGTTAGTTTGGTGGCACTGAACAATGT
GGCAGAGTTTATATGCAAATACAAACTATTATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_023233
Insert Size 1224 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_023233.3, NP_075722.1
RefSeq Size 1578 bp
RefSeq ORF 1224 bp
Locus ID 66597
UniProt ID Q9CYB0
Cytogenetics 14 D1
Gene Summary Endoplasmic reticulum (ER) membrane anchored E3 ligase involved in the retrotranslocation and turnover of membrane and secretory proteins from the ER through a set of processes named ER-associated degradation (ERAD). This process acts on misfolded proteins as well as in the regulated degradation of correctly folded proteins. Enhances ionizing radiation-induced p53/TP53 stability and apoptosis via ubiquitinating MDM2 and AKT1 and decreasing AKT1 kinase activity through MDM2 and AKT1 proteasomal degradation. Regulates ER stress-induced autophagy, and may act as a tumor suppressor. Plays also a role in innate immune response by stimulating NF-kappa-B activity in the TLR2 signaling pathway. Ubiquitinates TRAF6 via the 'Lys-29'-linked polyubiquitination chain resulting in NF-kappa-B activation. Participates as well in T-cell receptor-mediated NF-kappa-B activation. In the presence of TNF, modulates the IKK complex by regulating IKBKG/NEMO ubiquitination leading to the repression of NF-kappa-B.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) represents use of an alternate promoter and 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.