OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Chtop (NM_023215) Mouse Untagged Clone

Be the first to review this product
SKU
MC210383
Chtop (untagged) - Mouse RIKEN cDNA 2500003M10 gene (2500003M10Rik), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Chtop or NM_023215"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Chtop
Synonyms 2500003M10Rik; Fop; Srag
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC210383 representing NM_023215
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGAAGAACAAACAGCCGATGCCAGTGAATATTCGGGCTTCGATGCAGCAGCAGCAGCAGCTAGCCA
GTGCCAGAAACAGAAGACTGGCCCAGCAGATGGAGAATAGACCCTCTGTCCAGGCAGCATTAAAACTTAA
GCAGAAGAGCTTAAAGCAGCGCCTGGGTAAGAGTAATATCCAGGCACGGTTAGGCCGACCCATAGGTGCC
CTGGCCAGGGGAGCAATTGGAGGAAGAGGCCTACCCATAATCCAGAGAGGCTTGCCCCGAGGAGGACTAC
GTGGGGGACGTGCTACCAGAACCCTGCTTAGGGGTGGGATGTCGCTCCGAGGTCAAAACCTGCTCCGAGG
TGGACGAGCCGTAGCTCCCCGAATGGGCTTAAGAAGAGGTGGTGTTCGAGGTCGTGGAGGTCCTGGGAGA
GGGGGCCTAGGGCGTGGAGCTATGGGTCGTGGCGGAATCGGTGGTAGAGGTCGGGGTATGATAGGTCGGG
GAAGAGGGGGCTTTGGAGGCAGAGGCCGAGGTCGTGGCCGAGGGAGAGGTGCCCTCACTCGCCCTGTATT
GACCAAGGAGCAGCTGGACAACCAATTGGATGCATACATGTCGAAAACTAAAGGACACCTGGATGCTGAA
TTGGATGCCTACATGGCACAGACAGATCCTGAAACCAATGATTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_023215
Insert Size 675 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_023215.6, NP_075704.2
RefSeq Size 3721 bp
RefSeq ORF 675 bp
Locus ID 66511
UniProt ID Q9CY57
Cytogenetics 3 F1
Summary Plays an important role in the ligand-dependent activation of estrogen receptor target genes (By similarity). May play a role in the silencing of fetal globin genes (PubMed:20688955). Recruits the 5FMC complex to ZNF148, leading to desumoylation of ZNF148 and subsequent transactivation of ZNF148 target genes (PubMed:22872859). Required for the tumorigenicity of glioblastoma cells. Binds to 5-hydroxymethylcytosine (5hmC) and associates with the methylosome complex containing PRMT1, PRMT5, MEP50 and ERH. The CHTOP-methylosome complex associated with 5hmC methylates H4R3 and transactivates genes involved in glioblastomagenesis (PubMed:25284789).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream start codon compared to variant 1. The encoded isoform (3) has a shorter N-terminus compared to isoform 1. Variants 3 and 8 encode the same isoform. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_023215" in other vectors (4)
SKU Description Size Price
MG222783 Chtop (tGFP-tagged) - Mouse RIKEN cDNA 2500003M10 gene (2500003M10Rik), (10ug) 10 ug
$500.00
MR222783 Chtop (Myc-DDK-tagged) - Mouse RIKEN cDNA 2500003M10 gene (2500003M10Rik) 10 ug
$289.00 $300.00
MR222783L3 Lenti ORF clone of Chtop (Myc-DDK-tagged) - Mouse RIKEN cDNA 2500003M10 gene (2500003M10Rik) 10 ug
$600.00
MR222783L4 Lenti ORF clone of Chtop (mGFP-tagged) - Mouse RIKEN cDNA 2500003M10 gene (2500003M10Rik) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products