Hamp2 (NM_183257) Mouse Untagged Clone

CAT#: MC210367

Hamp2 (untagged) - Mouse hepcidin antimicrobial peptide 2 (Hamp2), (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Hamp2 (NM_183257) Mouse Untagged Clone
Symbol Hamp2
Synonyms 1810073K19Rik; HEPC2
Vector pCMV6-Entry
Sequence Data
>MC210367 representing NM_183257
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGGCACTCAGCACTCGGACCCAGGCTGCCTGTCTCCTGCTTCTCCTCCTTGCCAGCCTGAGCAGCA
CCACCTATCTCCAGCAACAGATGAGACAGACTACAGAGCTGCAGCCTTTGCACGGGGAAGAAAGCAGGGC
AGACATTGCGATCCCAATGCAGAAGAGAAGGAAGAGAGACATCAACTTCCCCATCTGCAGATTCTGCTGT
CAGTGCTGTAACAAACCCTCCTGTGGTATCTGTTGTGAAGAATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_183257
ORF Size 255 bp
Insert Size 255
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_183257.3, NP_899080
RefSeq Size 439
RefSeq ORF 255
Locus ID 66438
Cytogenetics 7 B1|7 19.27 cM
Gene Summary This gene encodes a peptide hormone that functions in the regulation of systemic iron metabolism. The encoded preproprotein is synthesized in the hepatocytes where it undergoes proteolytic processing to generate disulfide-linked mature peptides that are secreted into the bloodstream. Transgenic mice overexpressing the encoded protein develop normally with hematologic parameters similar to the non-transgenic mice. This gene is located adjacent to a related hepcidin gene on chromosome 7. [provided by RefSeq, Aug 2016].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.