Cenpw (NM_001109747) Mouse Untagged Clone
CAT#: MC210325
Cenpw (untagged) - Mouse centromere protein W (Cenpw), (10ug)
"NM_001109747" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Cenpw |
Synonyms | 2610036L11Rik; Cug2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210325 representing NM_001109747
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGCCCTCCACCACAGTCACTAGGCGGGTAAAGCGCAAGGCGCCCCGCGCCTTCCTCAAGCGCACCT TAAAGCAGAAGAAGCCTCACCTAGGTCTGGGGAGGTGCTGCGACCTCCTGATCCATTTGAATTGCCTACT TTTTATTCAGCGATTGGCAGAAGAGTCCAGGACAAATGCTTGTGAAAGTAAATCTAGAGTTATCAAAAAG GATCATGTACTGGCTGCAGGAAAGGTAATTCTGAAGAAGAGCAGAGGTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001109747 |
Insert Size | 261 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001109747.1, NP_001103217.1 |
RefSeq Size | 1527 bp |
RefSeq ORF | 261 bp |
Locus ID | 66311 |
UniProt ID | Q3URR0 |
Cytogenetics | 10 A4 |
Gene Summary | Component of the CENPA-NAC (nucleosome-associated) complex, a complex that plays a central role in assembly of kinetochore proteins, mitotic progression and chromosome segregation (By similarity). The CENPA-NAC complex recruits the CENPA-CAD (nucleosome distal) complex and may be involved in incorporation of newly synthesized CENPA into centromeres (By similarity). Part of a nucleosome-associated complex that binds specifically to histone H3-containing nucleosomes at the centromere, as opposed to nucleosomes containing CENPA. Component of the heterotetrameric CENP-T-W-S-X complex that binds and supercoils DNA, and plays an important role in kinetochore assembly. CENPW has a fundamental role in kinetochore assembly and function. It is one of the inner kinetochore proteins, with most further proteins binding downstream. Required for normal chromosome organization and normal progress through mitosis (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222004 | Cenpw (tGFP-tagged) - Mouse centromere protein W (Cenpw), (10ug) |
USD 350.00 |
|
MR222004 | Cenpw (Myc-DDK-tagged) - Mouse centromere protein W (Cenpw) |
USD 150.00 |
|
MR222004L3 | Lenti ORF clone of Cenpw (Myc-DDK-tagged) - Mouse centromere protein W (Cenpw) |
USD 450.00 |
|
MR222004L4 | Lenti ORF clone of Cenpw (mGFP-tagged) - Mouse centromere protein W (Cenpw) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review