Pigyl (NM_001082532) Mouse Untagged Clone

CAT#: MC210313

Pigyl (untagged) - Mouse phosphatidylinositol glycan anchor biosynthesis, class Y-like (Pigyl), (10ug)

USD 402.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Pigyl (NM_001082532) Mouse Untagged Clone
Symbol Pigyl
Synonyms 1810008A14Rik; PIG-Y; Pigy
Vector pCMV6-Entry
Sequence Data
>MC210313 representing NM_001082532
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATCCGGTCCCTGCCCACCATGACCGTCCTCATCCCACTGGTCTCGCTGGCAGGCCTGCTCTACTCCG
CCTCCGTGGAGGAAGGCTTCCCAGAGGGCTGCACCAGCGCCAGCAGCCTGTGCTTCTACAGCTTGCTCTT
GCCGGTCACCGTGCCTGTGTACGTGTTCTTCCATCTGTGGACATGGATGGGCCTGAAGCTCTTCAGACAT
AACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001082532
ORF Size 216 bp
Insert Size 216
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001082532.1, NP_001076001
RefSeq Size 692
RefSeq ORF 216
Locus ID 66268
Cytogenetics 9|9 A3
Gene Summary This gene encodes a homolog of a human protein that functions in glycosylphosphatidylinositol biosynthesis. The human protein is expressed from an unusual locus that encodes two distinct proteins in upstream and downstream CDSes; however, in mouse these two proteins are expressed from distinct loci. The product of this locus is highly similar to the protein expressed from the human downstream CDS. A separate mouse locus on chromosome 6 is orthologous to the human locus and encodes a protein similar to the human protein expressed from the upstream CDS. [provided by RefSeq, Jul 2008].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.