Chchd6 (NM_001167736) Mouse Untagged Clone

CAT#: MC210270

Chchd6 (untagged) - Mouse coiled-coil-helix-coiled-coil-helix domain containing 6 (Chchd6), transcript variant 2, (10ug)

  View "NM_001167736" in other vectors (6)

USD 410.00


Availability*
4 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Chchd6 (NM_001167736) Mouse Untagged Clone
Symbol Chchd6
Synonyms 0710001P09Rik; 1700021B03Rik
Vector pCMV6-Entry
Sequence Data
>MC210270 representing NM_001167736
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCAGCGCCGAGAGCGCCGAGGCCCGAAGGGTGTCCTTCGAGATGGATGAGGAGGAGCGGGTCCGGG
TGCTGCAGGGCATCCGGCTGTCTGAAAGTGTTGTGAACCGCATGAAGGATTGCAGCCAGCCTTCAGCAGG
GGAACAGCTGGTTCCTGGTTTTGGTCCTTCGTCTTCTGCTCCTGTGCCCACTGTCCCTCTACCAGCCATC
TCTGTGCCCACTGTCCCTGCACCTACCACTCCTGTGCCTACTGCTCCTTCATCCTCTGTACGTGGCCTGC
CAGGAGGCACCTGTAAAGGCCCTCTGACAGACGTTAAAGTGCCCAGTGCAGAGAGTGGTGGTGGTCTGCA
GTCCTCAGCAGTGAAGGAGGATCTTAAGAAGTTCCAACAGGAGCAGTTGGCAGTCCAGGATGAGATGGTC
AGGGTGGCAAAAAAGGAAAAAGAGGCAGCTGAGAAGCACTTGAAGGCATCCCTGCCCAAGAAGAAGGCCA
GCCTCACCCATGAGCAACAGCAGTCAGCTCGACTAAATGCTGAGCTGTATAAACTGTCTTCCCAACAATT
CCATGAGGCGGCTTCAAAAGCAGAGAGCACAATAAAGCCCCGCAGAGTGGAGCCTGTGTGCTCTGGCCTA
CAAGCCCAGATCCTCCGCTGTTACCGGGACCATCTGCATGAAGTGCTTCTGTGCTCGGACCTGGTCAAGG
CATACCAGCACTGTGTGAGCACTGCCCGCAAGGGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001167736
ORF Size 738 bp
Insert Size 738
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001167736.1, NP_001161208
RefSeq Size 1042
RefSeq ORF 738
Locus ID 66098
Cytogenetics 6|6 D1

Other Versions

Other products for "Chchd6"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies