Lamtor4 (NM_001081108) Mouse Untagged Clone
CAT#: MC210269
Lamtor4 (untagged) - Mouse RIKEN cDNA 0910001L09 gene (0910001L09Rik), (10ug)
"NM_001081108" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Lamtor4 |
Synonyms | 0910001L09Rik; AV006840 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210269 representing NM_001081108
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACTTCCGCACTGACCCAAGGGCTGGAGCGAATCCCAGACCAGCTTGGCTACCTGGTGCTGAGCGAAG GTGCAGTGCTGGCGTCATCTGGGGACCTTGAGAACGATGAGCAAGCAGCCAGTGCCATCTCGGAGTTGGT CAGCACAGCCTGTGGCTTCCAGTTGCACCATGGCACGAACATCCCTTTCAAACGCCTGTCTGTGGTCTTT GGTGAACACACGCTGCTGGTGACTGTGTCAGGACAGAGGGTGTTTGTAGTGAAGAGGCAGAACCGAGGTC GTGAACCTATTGATGTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001081108 |
Insert Size | 300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001081108.2, NP_001074577.1 |
RefSeq Size | 900 bp |
RefSeq ORF | 300 bp |
Locus ID | 66096 |
UniProt ID | Q8CF66 |
Cytogenetics | 5 G2 |
Gene Summary | As part of the Ragulator complex it is involved in amino acid sensing and activation of mTORC1, a signaling complex promoting cell growth in response to growth factors, energy levels, and amino acids. Activated by amino acids through a mechanism involving the lysosomal V-ATPase, the Ragulator functions as a guanine nucleotide exchange factor activating the small GTPases Rag. Activated Ragulator and Rag GTPases function as a scaffold recruiting mTORC1 to lysosomes where it is in turn activated (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG212545 | Lamtor4 (tGFP-tagged) - Mouse RIKEN cDNA 0910001L09 gene (0910001L09Rik), (10ug) |
USD 350.00 |
|
MR212545 | Lamtor4 (Myc-DDK-tagged) - Mouse RIKEN cDNA 0910001L09 gene (0910001L09Rik) |
USD 150.00 |
|
MR212545L3 | Lenti ORF clone of Lamtor4 (Myc-DDK-tagged) - Mouse RIKEN cDNA 0910001L09 gene (0910001L09Rik) |
USD 450.00 |
|
MR212545L4 | Lenti ORF clone of Lamtor4 (mGFP-tagged) - Mouse RIKEN cDNA 0910001L09 gene (0910001L09Rik) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review