Slc35b4 (NM_021435) Mouse Untagged Clone

CAT#: MC210176

Slc35b4 (untagged) - Mouse solute carrier family 35, member B4 (Slc35b4), (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Slc35b4 (NM_021435) Mouse Untagged Clone
Symbol Slc35b4
Synonyms 4930474D06Rik; AB041549; AW494345
Vector pCMV6-Entry
Sequence Data
>MC210176 representing NM_021435
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCGCCCGGCCTTCGCGGTGGGCCTGGTGTTCGCAGGCTGCTGCAGTAATGTGATCTTCCTAGAGCTGC
TGGCCCGGACACATCCAGGATGCGGGAACATCGTCACGTTTGCGCAGTTCTTATTTATTGCTGTGGAAGG
CTTCCTTTTTGAAGCTAACTTGGGAAGGAAGCCACCAGCTATCCCAATAAGGTACTATGCCATCATGGTA
ACCATGTTCTTCACTGTCAGCGTGGTGAACAACTATGCCCTGAACCTGAACATCGCCATGCCGCTGCATA
TGATATTCAGATCAGGCTCTCTGATTGCCAACATGATTCTAGGAATTATCATTTTGAAGAAAAGATACAG
TATGTTCAAGTATACCTCCATTGCCCTGGTGTCTGCAGGGATATTTATTTGCACTTTCATGTCAGCAAAG
CAGGTGACTGTCCAGACCGGCTTGAGTGACAAGGATGGATTCCAGGCCTTTGCATGGTGGTTACTAGGTA
TTGCGGCACTGACCTTCGCTCTGCTGATGTCGGCAAGAATGGGCATCTTCCAAGAGACTCTGTACAGACA
GTTTGGGAAGCACTCCAAGGAGGCGTTATTTTATAATCACGCCCTTCCACTTCCCGGGTTCATCTTCTTG
GCCTCTGATATTTATGACCACGTTGTCCTGTTCAATAAGTCTGAACTCTATCAAGTTCCAGTCATCGGTG
TGACGATGCCCGTCATGTGGTTCTACCTCCTCATGAATGTCGTGACTCAATATGTGTGCATCCGGGGTGT
GTTCATCCTTACAACAGAGTGTACCTCCCTCACCGTCACACTGGTTGTGACTCTGCGCAAGTTTGTGAGC
CTCATCTTTTCTATCTTGTACTTCCAGAACCAGTTCACTATGTGGCACTGGCTGGGCACCTCGTTTGTCT
TCATTGGAACCTTAATGTACACAGAGGTGTGGAAAAACCTCGGGACCACAAAAAGTGAGCTGCAAAAGGA
TGACAAGAAGGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_021435
ORF Size 996 bp
Insert Size 996
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_021435.3, NP_067410
RefSeq Size 3697
RefSeq ORF 996
Locus ID 58246
Cytogenetics 6|6 A3.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.