Dnajb2 (NM_178055) Mouse Untagged Clone

CAT#: MC210100

Dnajb2 (untagged) - Mouse DnaJ (Hsp40) homolog, subfamily B, member 2 (Dnajb2), transcript variant 2, (10ug)


  "NM_178055" in other vectors (4)

Reconstitution Protocol

USD 330.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Dnajb2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Dnajb2
Synonyms 2700059H22Rik; Dnajb10; Hsj1; mDj8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210100 representing NM_178055
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCATCCTACTACGAGATTCTAGACGTACCGCGGAGTGCGTCCCCTGATGACATCAAGAAGGCGTACC
GAAAGAAGGCTCTGCAGTGGCACCCAGACAAGAACCCGGATAATAAAGAATTTGCTGAAAAAAAATTTAA
GGAGGTGGCAGAGGCCTATGAAGTACTATCTGACAAGCACAAACGGGAGATCTATGACCGCTATGGCCGG
GAAGGGCTGACCGGGGCAGGAAGTGGTCCTTCTCGATCGGAAACTGGTGGTGCGGGGCCTGGCTTCACAT
TCACCTTCCGTAGCCCCGAGGAAGTCTTCCGGGAGTTCTTCGGGAGCGGAGACCCTTTTTCAGAGCTCTT
TGATGACTTGGGTGTCTTCTCGGAGCTTCAGAACCAGGGTCCCCGACTCACGGGCCCTTTCTTCACTTTC
TCTTCTTCCTTTCCTGCCAACTCCGATTTCTCCTCCTCATCTTTCTCCTTCAGCCCGGGGGCTGGTGCTT
TCCGCTCCGTTTCTACGTCCACCACCTTTGTCCAAGGCCGCCGCATCACCACACGCAGAATCATGGAGAA
CGGGCAGGAGCGGGTAGAAGTGGAAGAGGATGGACAACTGAAGTCAGTGTCAATCAATGGTGTCCCAGAT
GACCTGGCACTAGGCTTGGAGCTGAGCCGTCGTGAGCAGCAACCTTCAGTTGCCCCTGGGCTGGGGGTCA
TGCAGGTCCGGCCGACCTCTCTCTCTCGTCCCCCTGACCATGATCTTTCTGAGGATGAGGACCTGCAGCT
CGCCATGGCTTACAGCCTGTCAGAGATGGAGGCGGCTGGGCAGAAGCCAGCAGATGTGTTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_178055
Insert Size 834 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_178055.4, NP_835156.1
RefSeq Size 1935 bp
RefSeq ORF 834 bp
Locus ID 56812
UniProt ID Q9QYI5
Cytogenetics 1 C4
Gene Summary Functions as a co-chaperone, regulating the substrate binding and activating the ATPase activity of chaperones of the HSP70/heat shock protein 70 family. In parallel, also contributes to the ubiquitin-dependent proteasomal degradation of misfolded proteins. Thereby, may regulate the aggregation and promote the functional recovery of misfolded proteins like HTT, MC4R, PRKN, RHO and SOD1 and be crucial for many biological processes. Isoform 1 which is localized to the endoplasmic reticulum membranes may specifically function in ER-associated protein degradation of misfolded proteins.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 3' UTR and coding sequence compared to variant 3. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 3. Variants 2, 4, and 5 all encode isoform 2.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.